ID: 1018057505

View in Genome Browser
Species Human (GRCh38)
Location 6:160065086-160065108
Sequence CTGTGGTGACTGCATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018057500_1018057505 -10 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057505 6:160065086-160065108 CTGTGGTGACTGCATGGGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 303
1018057498_1018057505 -4 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057505 6:160065086-160065108 CTGTGGTGACTGCATGGGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018057505 Original CRISPR CTGTGGTGACTGCATGGGGA AGG Intronic