ID: 1018057507

View in Genome Browser
Species Human (GRCh38)
Location 6:160065092-160065114
Sequence TGACTGCATGGGGAAGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018057501_1018057507 -7 Left 1018057501 6:160065076-160065098 CCTGGAGCTGCTGTGGTGACTGC 0: 1
1: 0
2: 2
3: 38
4: 336
Right 1018057507 6:160065092-160065114 TGACTGCATGGGGAAGGGATTGG 0: 1
1: 0
2: 6
3: 24
4: 345
1018057500_1018057507 -4 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057507 6:160065092-160065114 TGACTGCATGGGGAAGGGATTGG 0: 1
1: 0
2: 6
3: 24
4: 345
1018057498_1018057507 2 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057507 6:160065092-160065114 TGACTGCATGGGGAAGGGATTGG 0: 1
1: 0
2: 6
3: 24
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018057507 Original CRISPR TGACTGCATGGGGAAGGGAT TGG Intronic