ID: 1018057509

View in Genome Browser
Species Human (GRCh38)
Location 6:160065118-160065140
Sequence TGAAGCAGAGAGTGGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018057501_1018057509 19 Left 1018057501 6:160065076-160065098 CCTGGAGCTGCTGTGGTGACTGC 0: 1
1: 0
2: 2
3: 38
4: 336
Right 1018057509 6:160065118-160065140 TGAAGCAGAGAGTGGACCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 252
1018057498_1018057509 28 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057509 6:160065118-160065140 TGAAGCAGAGAGTGGACCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 252
1018057500_1018057509 22 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057509 6:160065118-160065140 TGAAGCAGAGAGTGGACCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018057509 Original CRISPR TGAAGCAGAGAGTGGACCCC TGG Intronic