ID: 1018058482

View in Genome Browser
Species Human (GRCh38)
Location 6:160071690-160071712
Sequence GGGTGTTTCACTTACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018058477_1018058482 -2 Left 1018058477 6:160071669-160071691 CCTAAGTGTGTTGCTGCCTGTGG 0: 1
1: 0
2: 2
3: 23
4: 282
Right 1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1018058471_1018058482 25 Left 1018058471 6:160071642-160071664 CCTCAGCCTGAGGGAGCTTCCTG 0: 1
1: 1
2: 6
3: 61
4: 421
Right 1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1018058473_1018058482 19 Left 1018058473 6:160071648-160071670 CCTGAGGGAGCTTCCTGGTCCCC 0: 1
1: 0
2: 4
3: 27
4: 289
Right 1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1018058474_1018058482 6 Left 1018058474 6:160071661-160071683 CCTGGTCCCCTAAGTGTGTTGCT 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1018058476_1018058482 -1 Left 1018058476 6:160071668-160071690 CCCTAAGTGTGTTGCTGCCTGTG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1018058475_1018058482 0 Left 1018058475 6:160071667-160071689 CCCCTAAGTGTGTTGCTGCCTGT 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018058482 Original CRISPR GGGTGTTTCACTTACCTGCA GGG Intronic
901600067 1:10416689-10416711 GGGTTTTTCTCTTACGGGCAGGG + Intronic
901947275 1:12713943-12713965 GGGTTTTTCTCTTACGGGCAGGG - Intergenic
902338425 1:15767302-15767324 GAGGGTTTTACTTACCTACATGG - Intronic
904367544 1:30024462-30024484 GGGGGGTTCACATGCCTGCATGG - Intergenic
907381801 1:54096837-54096859 TTGAGTTTCAGTTACCTGCAGGG - Exonic
909040369 1:70642206-70642228 GGTTATTTCCCTCACCTGCATGG - Intergenic
911580540 1:99628704-99628726 GGGTGTGTGACTTATCAGCAGGG - Intergenic
918042388 1:180921194-180921216 GGGTTTTTCTCTTACGGGCAGGG + Intronic
923190113 1:231612113-231612135 GGATGATTCACTTCCCTGTATGG + Intronic
923386805 1:233472981-233473003 GGGTTTTTCTCTTACAGGCAGGG + Intergenic
924382231 1:243475293-243475315 GGGTCTTTCTATTGCCTGCAGGG + Intronic
924926473 1:248688759-248688781 AGGTGTTTCAGTTGACTGCAGGG + Intergenic
1067327621 10:45284705-45284727 GAGTGTCTCACCTTCCTGCATGG - Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1074158547 10:110818605-110818627 GGTTGTTTCCTTTGCCTGCAGGG + Intronic
1075006296 10:118832554-118832576 GGGTGTTTCGCATGCCTGCTGGG - Intergenic
1081681524 11:45009006-45009028 GGCTTTTTCACTTCCCTGCTTGG + Intergenic
1083484840 11:62976867-62976889 GTCTGTTTCCCTTTCCTGCAGGG + Exonic
1084382318 11:68820761-68820783 GGGTGATTCACGTCCCTGGAAGG - Intronic
1089025434 11:115264940-115264962 GTGTTGTTCACTTACCTTCATGG - Intronic
1091129129 11:133129267-133129289 GGGTAGTTCCCTTACGTGCATGG - Intronic
1095848983 12:46779628-46779650 TGGATTTTCTCTTACCTGCATGG - Exonic
1096090588 12:48897838-48897860 GGATGTTTCATTCACCTTCATGG + Intergenic
1096266330 12:50125585-50125607 GGGGGTTTCAGTTTCCTGCCTGG + Intergenic
1096308354 12:50498719-50498741 GGGTGTTCCACCTTCCGGCATGG + Intergenic
1099347886 12:81525430-81525452 GAATATTTCCCTTACCTGCAGGG - Intronic
1108196673 13:48001951-48001973 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
1115667552 14:35569762-35569784 GGGTCTCTCACTCACCTGGATGG - Intronic
1118436270 14:65773525-65773547 GGGTGTCTCACTTGGGTGCATGG + Intergenic
1119594107 14:75917867-75917889 CGGAGTTTCTGTTACCTGCAGGG - Intronic
1121618137 14:95327513-95327535 GGGTTTTTCACTCACCTGCTTGG - Intergenic
1121702772 14:95968449-95968471 GGGTTTTTCTCTTACGGGCAGGG - Intergenic
1124401922 15:29356008-29356030 GGGAGTATCACTTACCTACGAGG + Intronic
1126437772 15:48653435-48653457 GGGTGTTTCACCATCCTTCACGG + Intergenic
1132512067 16:348218-348240 TGTTGTTTCAGTCACCTGCATGG - Intronic
1133757805 16:8775846-8775868 GGGTGTTTCAGTTAGCCGCATGG + Intronic
1133862284 16:9607352-9607374 GGGTGAGTTACTTACCTTCAAGG + Intergenic
1140897994 16:79342161-79342183 GGGTGTGCCACCTACCTGCCGGG - Intergenic
1144265389 17:13563347-13563369 GGCTCTTTCAGTTACCTGGAGGG + Intronic
1146524780 17:33557227-33557249 TGGTTTTTCACTTACTTGCTAGG - Intronic
1146823203 17:36001012-36001034 GGGTGAGTCACTTACCTGGCTGG + Intronic
1150799689 17:68270824-68270846 GTGTATTTAAATTACCTGCAAGG + Exonic
1158195960 18:54885370-54885392 GAGTCCTTCACTTACCTACAAGG + Intronic
1161794195 19:6376961-6376983 GGCTGTTTCACTTGCCTGTGTGG - Intronic
1165158339 19:33801652-33801674 GGGAGTCTCACGTACCTTCAAGG + Intronic
1166225407 19:41392066-41392088 GGATGGTGCAGTTACCTGCAGGG + Intronic
1167147062 19:47688041-47688063 GGGTGTGTCACTTTCCAGCCTGG - Intronic
926614272 2:14979914-14979936 GGGTGATTCCATTACCTTCAGGG - Intergenic
927133891 2:20082801-20082823 GGGTTTTTCTCTTACGGGCAGGG - Intergenic
927134661 2:20087931-20087953 GGGTTTTTCTCTTACAGGCAGGG - Intergenic
942838333 2:180328796-180328818 CAGTGTTTCTCTTCCCTGCAAGG + Intergenic
943085358 2:183304457-183304479 GCTTGTTTCACTAACCAGCAGGG + Intergenic
943247843 2:185478122-185478144 GGGGGTTTCACTCCACTGCAAGG - Intergenic
945029529 2:205650508-205650530 GAGTGACTCACTTAGCTGCAGGG - Intergenic
1171971788 20:31569417-31569439 GGGGGTTTCTTTTGCCTGCAGGG - Exonic
1171991391 20:31699236-31699258 GGGTGTTCCACCTGTCTGCAGGG - Intronic
1172956327 20:38762166-38762188 GGGTTTTTTACTTACCTGTCTGG + Intronic
1173191611 20:40881174-40881196 GGGTGTTTTAATTACAGGCATGG + Intergenic
1175860074 20:62145332-62145354 GGCTGTGCCACTTACCAGCAAGG - Intronic
1178899815 21:36589718-36589740 GGGTTTGTCATTTACCTGAATGG - Intergenic
1179571908 21:42283473-42283495 AGGTGTTTCACTGTCCAGCAGGG - Intronic
1179966192 21:44807547-44807569 GGGTGTTTCACTACCTTGCCTGG - Intronic
1181264733 22:21624307-21624329 GGGTGCATCACTTACATGCGTGG + Intergenic
1181395296 22:22616994-22617016 GAGTCTGTCACTGACCTGCAGGG - Intergenic
951996162 3:28732161-28732183 TGATATTTCACTTACCTGAATGG + Intergenic
952379928 3:32796632-32796654 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
957674933 3:83354347-83354369 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
961238702 3:125391067-125391089 GGCTGCTTCAGTTATCTGCAAGG + Intergenic
961435920 3:126916603-126916625 GGGTGCTGCACTGCCCTGCAGGG + Intronic
962068236 3:132006102-132006124 TGTTGTTTTATTTACCTGCAGGG + Intronic
967051241 3:185786543-185786565 GGGTTTTTCTCTTACGGGCAGGG - Intronic
967761366 3:193229562-193229584 AGGTGACTCACTAACCTGCATGG - Intergenic
967826443 3:193881489-193881511 AGGTGTTTCAGTGACCGGCAGGG - Intergenic
968073763 3:195804593-195804615 CAGTGTTTCACTTTCCTGGAGGG + Intronic
971763586 4:30801320-30801342 GGGTATTTCATTTACTTGCATGG - Intronic
974051584 4:56946885-56946907 GGGTGTTTTCCTCATCTGCAGGG + Intergenic
974741695 4:66014733-66014755 GGGAGTTTCCCTTCCCTGCATGG + Intergenic
976983936 4:91268720-91268742 GGGTTTTTCTCTTACAGGCAGGG + Intronic
981347916 4:143697962-143697984 GGGAGTGTCTCTTACCAGCATGG - Exonic
985183708 4:187293835-187293857 GTGCATTTCAGTTACCTGCATGG + Intergenic
987768491 5:22268019-22268041 GATTGTTCCACTTCCCTGCATGG - Intronic
997582389 5:135026119-135026141 GGGTCTTTCACTCACCTGCTTGG + Intergenic
997729754 5:136160008-136160030 GTTTGTTTCAGTTTCCTGCATGG + Intronic
998446651 5:142204076-142204098 GGGTGTTTTACTTCTCTGCGAGG + Intergenic
1000355996 5:160396404-160396426 GTGTGTTACACTTAGCAGCAAGG - Intronic
1005626622 6:27668672-27668694 GGGCCCTTCACTTACCTGAAGGG + Intergenic
1005649436 6:27873178-27873200 GAGTGTTTTACTTACTTACACGG - Exonic
1006447626 6:34088754-34088776 GGGTGTTTCACCTAGCCACATGG + Intronic
1007084873 6:39136244-39136266 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
1010560254 6:77340555-77340577 GGGGATTTCACTTCCCTGAAGGG - Intergenic
1015201092 6:130582234-130582256 GGGTAATTTAATTACCTGCAGGG + Intergenic
1017345373 6:153373384-153373406 GTGTGTTTCCCTTATCTGAAAGG - Intergenic
1017620901 6:156295984-156296006 GGACTTTTCACTTACCTGCTGGG - Intergenic
1018058482 6:160071690-160071712 GGGTGTTTCACTTACCTGCAGGG + Intronic
1019379426 7:713128-713150 GGTTGATTCCCTTTCCTGCAGGG - Exonic
1020446054 7:8269148-8269170 AGGTGTTGCCCTCACCTGCATGG - Intergenic
1023302372 7:38787200-38787222 GGGTAGTTGACTTACATGCAAGG - Intronic
1024678510 7:51659595-51659617 GGATGTTTCACTTTTCTCCAAGG + Intergenic
1040815432 8:51503292-51503314 GGTTGTCTTACTTTCCTGCAAGG - Intronic
1044094217 8:88042389-88042411 GGGGCTTTCATTTGCCTGCAAGG + Intronic
1050065920 9:1759357-1759379 GGGTAGTTCACTGATCTGCATGG - Intergenic
1051051597 9:12939563-12939585 GAGTTTTTCACTTAACTGCAGGG - Intergenic
1051365110 9:16316418-16316440 GGGCCTTTCACTTGCCTGCAAGG - Intergenic
1053165677 9:35842100-35842122 GGCTGTCTCACTGACTTGCAAGG - Intronic
1054953235 9:70877499-70877521 GGGAGTTTCAGTTCCCTGGAGGG - Intronic
1056778006 9:89527912-89527934 GGGTGATTCACCTCCCAGCAGGG - Intergenic
1185954246 X:4471843-4471865 GATTGTTTCAGTTACCTGTAGGG + Intergenic
1186626011 X:11294835-11294857 GGGTGTTTTACTCACAGGCATGG - Exonic
1189179004 X:38985677-38985699 GTGTGTTTAAATTTCCTGCAAGG - Intergenic
1193651920 X:84146725-84146747 GTGTTTTTCACTTACCTGTCTGG - Intronic
1197451683 X:126627675-126627697 AGATATTTCACTTACATGCATGG - Intergenic
1200259120 X:154602580-154602602 GGTTGTTTTACTTACCTGAAGGG - Intergenic
1201742466 Y:17338361-17338383 GATTGTTTCAGTTACCTGTAGGG + Intergenic
1202032576 Y:20593529-20593551 GGTCGTTTCAGTTACCTGAATGG + Intergenic