ID: 1018058943

View in Genome Browser
Species Human (GRCh38)
Location 6:160075112-160075134
Sequence CATGCACGTGTGTGTGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 1, 2: 21, 3: 88, 4: 583}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018058943_1018058944 10 Left 1018058943 6:160075112-160075134 CCACATGCACACACACGTGCATG 0: 1
1: 1
2: 21
3: 88
4: 583
Right 1018058944 6:160075145-160075167 TTCATCACATACACAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018058943 Original CRISPR CATGCACGTGTGTGTGCATG TGG (reversed) Intronic