ID: 1018060805

View in Genome Browser
Species Human (GRCh38)
Location 6:160088204-160088226
Sequence TGCCCATGAAAACCCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018060805_1018060811 6 Left 1018060805 6:160088204-160088226 CCTCCTTGGGGTTTTCATGGGCA 0: 1
1: 0
2: 0
3: 25
4: 282
Right 1018060811 6:160088233-160088255 GGCTGAGTCTTAGGAGCTCAGGG 0: 1
1: 0
2: 0
3: 17
4: 193
1018060805_1018060810 5 Left 1018060805 6:160088204-160088226 CCTCCTTGGGGTTTTCATGGGCA 0: 1
1: 0
2: 0
3: 25
4: 282
Right 1018060810 6:160088232-160088254 TGGCTGAGTCTTAGGAGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 183
1018060805_1018060809 -3 Left 1018060805 6:160088204-160088226 CCTCCTTGGGGTTTTCATGGGCA 0: 1
1: 0
2: 0
3: 25
4: 282
Right 1018060809 6:160088224-160088246 GCAGGTTTTGGCTGAGTCTTAGG 0: 1
1: 0
2: 1
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018060805 Original CRISPR TGCCCATGAAAACCCCAAGG AGG (reversed) Intronic
900546684 1:3233348-3233370 TGCCATTGCAAACCCCAAAGTGG - Intronic
901196347 1:7442065-7442087 TCTCCATGGAAACCCCATGGAGG - Intronic
902046712 1:13530102-13530124 TGCCTCTGTAAACCCCCAGGTGG - Intergenic
902637070 1:17741562-17741584 CGCCCCTTAAAACCTCAAGGAGG + Intergenic
903424664 1:23244982-23245004 GGCCCTCGTAAACCCCAAGGAGG + Intergenic
903832526 1:26183584-26183606 GGCCCATGGAAGCCCCCAGGAGG + Intronic
906339323 1:44964552-44964574 TGCCAATGAAATCCCCATGCTGG - Intronic
906809865 1:48815111-48815133 TTCCAATGAAAACCACAATGAGG - Intronic
907321707 1:53606712-53606734 TGGCCATGAATGCCCCAAGGCGG - Intronic
907686109 1:56613437-56613459 TGCAAATGAAAACCACAATGAGG + Intronic
908454209 1:64286050-64286072 TGCCCATTAAAGCCACAATGAGG - Intergenic
910110695 1:83679820-83679842 TGGACATCAAAACCACAAGGAGG - Intergenic
915787007 1:158624322-158624344 AGCCCATGAAAGCACCTAGGAGG + Intronic
916020700 1:160789792-160789814 TACCTATGAAAAGACCAAGGAGG + Intergenic
916466659 1:165080131-165080153 TGCCCATGAAAGCAGCCAGGAGG + Intergenic
917582264 1:176391221-176391243 TCCCCATGAAAACCCCATCCAGG - Intergenic
917707335 1:177647669-177647691 GCCCCATGAATCCCCCAAGGTGG - Intergenic
918096386 1:181338384-181338406 TGCACATCAAAACCACAAAGGGG - Intergenic
918356318 1:183708943-183708965 CGCCAATGAACACCACAAGGCGG + Intronic
919247973 1:195013821-195013843 AGCCCATGAAAACAGCTAGGAGG - Intergenic
919974770 1:202603287-202603309 GGCCCATCAGAACCCCTAGGTGG + Intronic
920484298 1:206354399-206354421 TTCCCATGAAAACCCCAGAAAGG - Intronic
921165639 1:212504928-212504950 TCCTCATGACAACCCCAAGAGGG + Intergenic
1063061960 10:2565191-2565213 GGCCCATGTAGACCCAAAGGTGG - Intergenic
1068028854 10:51683183-51683205 TGCACATCAAAACCACAATGAGG + Intronic
1068400262 10:56518889-56518911 AGCCCATGAAAGCAGCAAGGAGG - Intergenic
1069732164 10:70624054-70624076 TGCCCAAGAAAATCTCAAGCCGG - Intergenic
1070177338 10:73982569-73982591 TGCCAATGAAAAGCCCAATTTGG + Intergenic
1070570243 10:77635926-77635948 TGGCTATGAAAACACCAGGGGGG - Intronic
1070584818 10:77756159-77756181 TGCAAATCAAAACCCCAGGGAGG + Intergenic
1071071753 10:81702333-81702355 TGCAAATGAAAACCACAATGAGG + Intergenic
1071133479 10:82424363-82424385 TGCACATCAAAACCTCAATGAGG - Intronic
1071988743 10:91078194-91078216 TTCCCTTTAAATCCCCAAGGTGG + Intergenic
1073412628 10:103354771-103354793 TGCAAATCAAAACCACAAGGAGG + Intergenic
1077349181 11:2083603-2083625 TGCAAATCAAAACCACAAGGAGG - Intergenic
1077827514 11:5826818-5826840 GGCCCATGAAAACAGCCAGGAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079102318 11:17549365-17549387 TAGACATGAAGACCCCAAGGTGG + Intronic
1079342669 11:19625761-19625783 TGCACATCAAAACCACAATGGGG - Intronic
1079657795 11:23003684-23003706 TGCCCATGAAAACAGCTGGGAGG - Intergenic
1080235281 11:30061207-30061229 TGCCCAGGAAAAACCGAAGAAGG + Intergenic
1085588262 11:77732064-77732086 AGCCCATGAAAACAGCCAGGAGG + Intronic
1089392714 11:118113028-118113050 TGCCCAACGAAACCTCAAGGAGG - Intronic
1090098149 11:123764425-123764447 TGCAGTTGAAAACCACAAGGTGG - Intergenic
1090999940 11:131901976-131901998 TGCCCATGTCAACCCCAGGTTGG + Intronic
1091232125 11:133995300-133995322 TGCAAATCAAAACCACAAGGAGG + Intergenic
1092796308 12:12113432-12113454 TTCCCATGGAATCCCCAAGAAGG + Intronic
1093906617 12:24700988-24701010 TGCAAATGAAAACCTCAATGAGG + Intergenic
1094253910 12:28399886-28399908 TGCCCATGAAAGCAGCCAGGAGG - Intronic
1094886550 12:34881966-34881988 TTCCAATGAAGACCCCAATGAGG - Intergenic
1094899486 12:35092231-35092253 TTCCAATGAAGACCCCAATGAGG - Intergenic
1094925510 12:35513252-35513274 TTCCAATGAAGACCCCAATGAGG - Intergenic
1094927741 12:35549583-35549605 TTCCAATGAAGACCCCAATGAGG - Intergenic
1094928612 12:35563512-35563534 TTCCAATGAAGACCCCAATGAGG - Intergenic
1094967604 12:36194636-36194658 TTCCAATGAAGACCCCAATGAGG - Intergenic
1094992215 12:36592785-36592807 TTCCAATGAAAGCCCCAATGAGG - Intergenic
1095009690 12:36875464-36875486 TTCCAATGAAGACCCCAATGAGG - Intergenic
1095213935 12:39526680-39526702 AGCCCATGAAAACAGCCAGGAGG - Intergenic
1095218889 12:39584230-39584252 TGCACATCAAAACCACAATGAGG - Intronic
1095984150 12:47988584-47988606 TTGCCATGGAAACCCCCAGGAGG + Intronic
1098592083 12:72226080-72226102 TGCCTATGCACACCCAAAGGTGG - Intronic
1099674616 12:85742784-85742806 AGCCCATGAAAACAGCAGGGAGG - Intergenic
1100748545 12:97672247-97672269 TGCCCATGAAACTGCCAAAGGGG - Intergenic
1101486761 12:105171885-105171907 TGCCCAAGAAAACCACATGGGGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102879666 12:116474541-116474563 TGCCTAAGAAAATCCGAAGGAGG + Intergenic
1103384690 12:120522877-120522899 GGCCCTTGTAAAGCCCAAGGAGG - Intronic
1103675121 12:122649791-122649813 TACCCATAAAAATCCAAAGGAGG - Intergenic
1108253936 13:48592907-48592929 GCCACAGGAAAACCCCAAGGGGG - Intergenic
1108770421 13:53693956-53693978 TTGCCATGACAACACCAAGGGGG + Intergenic
1110359702 13:74611060-74611082 AGCCCATGAAAACAGCCAGGAGG + Intergenic
1112834978 13:103503759-103503781 TGCAAATCAAAACCACAAGGAGG - Intergenic
1113845973 13:113391844-113391866 TGTCCAAGAAAAGCTCAAGGAGG - Intergenic
1115019506 14:28659283-28659305 TGCCCATCAAAACCCAAATGAGG + Intergenic
1115113724 14:29855231-29855253 GGCCCATGAAAACAGCCAGGAGG + Intronic
1115738119 14:36357327-36357349 TGCAAATGAAAACCACAATGAGG + Intergenic
1116154438 14:41185702-41185724 AGCCCATGAAAACATCCAGGAGG - Intergenic
1116256086 14:42558316-42558338 TGCCAATCAAAACCACAATGAGG + Intergenic
1116811601 14:49545039-49545061 TGCCCTTGAAAAAACCATGGTGG + Intergenic
1119152902 14:72380600-72380622 TGCCAATCAAAACCACAATGAGG + Intronic
1119727878 14:76933105-76933127 TTCCCTTGCAAATCCCAAGGGGG - Intergenic
1119893100 14:78197709-78197731 TGGTCATGAATACCCCATGGAGG - Intergenic
1120969015 14:90191994-90192016 AGCCCATGAAGACCCCAGTGAGG - Intergenic
1121503739 14:94460679-94460701 TGCCCATGAAAACACAGAGAGGG - Intergenic
1122022711 14:98852344-98852366 TTCCCATGTAAGCACCAAGGGGG + Intergenic
1122456892 14:101860735-101860757 TGCACATCAAAACCACAATGAGG - Intronic
1125060961 15:35423257-35423279 TGCCAATCAAAACCACAATGAGG - Intronic
1125265913 15:37880743-37880765 TGCACAGCAAAACCACAAGGTGG - Intergenic
1125347411 15:38732252-38732274 TGCCCATGTAATCTCCAAGAAGG + Intergenic
1125686006 15:41563774-41563796 TGCAAATAACAACCCCAAGGGGG + Intronic
1125827462 15:42688582-42688604 TGCCCTTGAATTCTCCAAGGTGG + Exonic
1127476831 15:59342090-59342112 TGCCAATGAAAACTACAATGAGG - Intronic
1128543800 15:68554357-68554379 GGCCCAAGCAAACCCCAAAGAGG + Intergenic
1129379164 15:75154606-75154628 TCCCCATGCAAACCTCAAAGAGG + Intergenic
1130165480 15:81453024-81453046 TGCAAATCAAAACCACAAGGAGG - Intergenic
1130174279 15:81551661-81551683 TGCAAATCAAAACCACAAGGAGG + Intergenic
1132097287 15:98997159-98997181 AGCCCATGAAAGCCCCAAGCTGG + Intronic
1133518658 16:6534869-6534891 TGACCATGAAAAGTCCAATGAGG + Intronic
1134562057 16:15219338-15219360 TGCCCATGCAAACCCCAGCTAGG + Intergenic
1134922595 16:18130967-18130989 TGCCCATGCAAACCCCAGCTAGG + Intergenic
1136146021 16:28317251-28317273 GGCCCAAGATAACCACAAGGGGG - Intronic
1136751756 16:32642874-32642896 TTGCCATGAAAACACCAAGGGGG - Intergenic
1137277714 16:46947502-46947524 TGCAAATCAAAACCACAAGGAGG - Intergenic
1140319955 16:73940936-73940958 TTCCCATGAACACCCCTGGGAGG - Intergenic
1141057260 16:80830135-80830157 TACACATGAAAACCCCCAAGGGG - Intergenic
1141576706 16:84968596-84968618 TCTCCAAGTAAACCCCAAGGAGG - Intergenic
1141691659 16:85600177-85600199 TTCCCGTGAATAACCCAAGGTGG - Intergenic
1203053892 16_KI270728v1_random:902128-902150 TTGCCATGAAAACACCAAGGGGG - Intergenic
1142964229 17:3571015-3571037 TGAGCAGAAAAACCCCAAGGAGG - Intronic
1145378129 17:22370689-22370711 AGCCCATGAAAACAGCCAGGAGG - Intergenic
1145685113 17:26647942-26647964 TTCCAATGAAGACCCCAAAGTGG - Intergenic
1145849584 17:28079570-28079592 TGCAAATGAAAACCACAATGAGG - Intronic
1146271893 17:31490078-31490100 TGCCCCTGGAACCCCAAAGGAGG - Intronic
1148331829 17:46818116-46818138 TGCCCATGAAGACCCCAAAATGG + Intronic
1150092944 17:62345514-62345536 TGCAAATCAAAACCCCAATGTGG - Intergenic
1151582178 17:74986486-74986508 TGCAAATGAAAACCACAATGAGG - Intergenic
1152350217 17:79780061-79780083 TGCCCTTGAACATCTCAAGGAGG - Intronic
1152896413 17:82913908-82913930 TGCCCACGACAACCACACGGAGG - Intronic
1154397923 18:14008839-14008861 TGCAAATGAAAACCACAATGAGG - Intergenic
1156027295 18:32669740-32669762 TGCCCATGTACACCACCAGGGGG - Intergenic
1156379965 18:36549136-36549158 TGCCAATTAAAACCCCAGTGAGG - Intronic
1157946342 18:51984834-51984856 TCACCATGACAACACCAAGGGGG + Intergenic
1159958200 18:74534584-74534606 GTCCCATGAAAGCCCCAAGAGGG - Exonic
1160213516 18:76905397-76905419 AGCACATGAAAACCCACAGGTGG + Exonic
1162521872 19:11185739-11185761 TGCCAATGAAAACAATAAGGAGG + Intronic
1163295599 19:16410292-16410314 TGCCAATGAAATCCACAATGAGG + Intronic
1164426623 19:28147539-28147561 TGCCCCTGAACACTCCAAGTCGG - Intergenic
1164789390 19:30963251-30963273 TGCCCAGGAAGACCCTGAGGAGG - Intergenic
1164851115 19:31485077-31485099 AGCCCATGAAAACAGCCAGGAGG - Intergenic
1165739783 19:38198270-38198292 TGCCCAGGAAAACCTCCAGCAGG - Intronic
1165974737 19:39665832-39665854 AGCCCATGAAAACAGCCAGGAGG - Intergenic
1166673243 19:44724032-44724054 TGCCCATGGCAACCGCTAGGTGG + Intergenic
926024419 2:9528717-9528739 TGCAAATCAAAACCCCAATGGGG + Intronic
926181150 2:10644337-10644359 GGCCAATGAAACCCCCAAGATGG - Exonic
927905920 2:26856560-26856582 TGTCCATGAAAGCCCCAAACCGG - Intronic
928975158 2:37079026-37079048 GGACCATAAAAACCCCCAGGTGG - Intronic
929626803 2:43417561-43417583 TGCCAACGAAATGCCCAAGGGGG + Intronic
930144397 2:47986461-47986483 TGCACATCAAAACCACAAGGAGG - Intergenic
930194620 2:48496832-48496854 TCTCCATGAAAAGCCCAAGAGGG + Intronic
930395512 2:50818939-50818961 TGCAAATCAAAACCACAAGGAGG + Intronic
931543899 2:63359445-63359467 TGCAAATGAAAACCCCAATGAGG + Intronic
931648374 2:64446129-64446151 TGCAAATCAAAACCACAAGGAGG + Intergenic
932409387 2:71536248-71536270 TGCCCATGACACCCCCAACCAGG + Intronic
932418254 2:71586559-71586581 TCCACATGGAAATCCCAAGGAGG + Intronic
932546288 2:72714044-72714066 TACCCTTGAAAGCCACAAGGTGG + Intronic
935306674 2:101743505-101743527 TGCCCATGAAAAGCTCAACAAGG - Intronic
935748328 2:106209166-106209188 TGCACAAGAAAACCCAGAGGAGG + Intergenic
935798859 2:106672084-106672106 TTGCCATGACAACACCAAGGAGG - Intergenic
938644591 2:133317864-133317886 TGACCATGAAAAGGCCAAGCTGG + Intronic
939128381 2:138204817-138204839 AGCCCATGAAAGCAGCAAGGAGG - Intergenic
942053222 2:172160210-172160232 TGCCAATCAAAACCACAATGAGG - Intergenic
942936471 2:181562393-181562415 GGCCTATGATAACCCCAGGGGGG - Intronic
943998114 2:194797396-194797418 TGCCCATGAAAACAGCCAGGAGG + Intergenic
945713518 2:213330290-213330312 AGCCCATGAAAGCACCCAGGAGG + Intronic
946878718 2:224156718-224156740 TTCCCTTGACAACCCCAAAGAGG - Intergenic
946882185 2:224187594-224187616 TTGCCATGACAACACCAAGGGGG - Intergenic
947302197 2:228700466-228700488 TGCACATGCATACCCCAATGAGG + Intergenic
948388254 2:237595019-237595041 TCCGCAAGAAAACCCCAAGGAGG - Exonic
948689853 2:239695107-239695129 TGCACTTGAAAACACTAAGGAGG + Intergenic
948694859 2:239728090-239728112 TGCCCTTGAAAATCACAGGGTGG - Intergenic
1169956246 20:11106296-11106318 TGCCCCTGAAACCCCCCTGGAGG - Intergenic
1170875234 20:20244099-20244121 AGCCCATGAAAACAGCCAGGAGG - Intronic
1171214731 20:23344134-23344156 TGCAAATCAAAACCCCAATGAGG - Intergenic
1171855663 20:30340534-30340556 AGCCCATGAAAACAGCCAGGAGG + Intergenic
1173700224 20:45063303-45063325 TGCAAATGAAAACCACAATGAGG - Intronic
1174079470 20:47960807-47960829 TCCCCATGTGAACCCCAAGGGGG + Intergenic
1175852348 20:62100314-62100336 TGCCCATGAGAGCCCCTGGGAGG - Intergenic
1177487444 21:21777758-21777780 AGCCCATGAAAACACCCAGGTGG - Intergenic
1178188479 21:30253217-30253239 TGCACATCAAAACTACAAGGAGG + Intergenic
1179378554 21:40877019-40877041 TGCAAATGAAAACCACAATGAGG + Intergenic
1179454122 21:41486813-41486835 TGCAAATGAAAACCACAATGAGG + Intronic
1179594554 21:42433724-42433746 TGCCCATGGAAATCCCAGGGAGG + Intronic
1179642946 21:42759099-42759121 TGCCCAGGAAGAACCGAAGGCGG - Intronic
1180573711 22:16752871-16752893 AGCCCATGAAAACAGCCAGGAGG + Intergenic
1182608223 22:31524307-31524329 TGCAAATGAAAACCACAATGAGG - Intronic
1183375194 22:37460189-37460211 TGCCAATCAAAACCACAATGAGG + Intergenic
1184518549 22:44978657-44978679 TGCTGATGAAAACCACAGGGAGG - Intronic
1184878468 22:47290261-47290283 TTCTCATGAAAACCACGAGGAGG + Intergenic
949836589 3:8276731-8276753 AGGCCATGGAAACCCCAGGGAGG - Intergenic
949895360 3:8764235-8764257 TTATCATGAAAACCCCAGGGAGG - Intronic
949940981 3:9154234-9154256 TGCCAATGAAAAAGGCAAGGAGG - Intronic
951126976 3:18995925-18995947 AGCCCATGAAAACAGCCAGGAGG - Intergenic
952985966 3:38783628-38783650 TGCCCATAAAAACCCCAAACCGG - Intronic
953288335 3:41635273-41635295 TGACCATGAAAACCTTAAGATGG + Intronic
953480299 3:43245726-43245748 TGCAGATGAAAATTCCAAGGTGG - Intergenic
953509506 3:43521572-43521594 TGCAAATCAAAACCACAAGGAGG + Intronic
954420322 3:50415551-50415573 AGCCCATGGTAACCCCAAGGAGG - Intronic
955350214 3:58188080-58188102 TGCCCGTGAAAGCCACAATGGGG - Intergenic
956149380 3:66225006-66225028 AGCCCATGAAAACAGCCAGGAGG - Intronic
956213570 3:66826064-66826086 TGCCCAAGATATCCCAAAGGAGG + Intergenic
959730171 3:109591870-109591892 TGCAAATGAAAACCACAATGAGG + Intergenic
960015239 3:112879972-112879994 TGCGAATGAAAACCACAATGAGG - Intergenic
960801333 3:121543681-121543703 TGCCCATGAAAACCCATATAGGG + Intronic
961055318 3:123783255-123783277 TGCCAATCTAAGCCCCAAGGAGG + Intronic
961177879 3:124850904-124850926 TGCCCATGCAAGGGCCAAGGAGG - Intronic
961962020 3:130865050-130865072 AGCCCATGAAAGCAGCAAGGAGG + Intronic
962784694 3:138757103-138757125 TGCACATAAAAACCACAATGAGG + Intronic
963171850 3:142259223-142259245 TGCCAATAAAAACCCAAAGGAGG + Intergenic
963668420 3:148220342-148220364 TGTTCAAGAAAACCCCAAAGGGG - Intergenic
964654603 3:159052378-159052400 AGCCCATGAAAACAGCCAGGAGG + Intronic
964655582 3:159062989-159063011 TGCCCATAAGAACCCTAAGAGGG - Intronic
965013378 3:163125828-163125850 AGCCCATGAAAACAGCCAGGAGG - Intergenic
965288497 3:166846456-166846478 TGCAAATGAAAACCACAATGAGG - Intergenic
967524999 3:190482209-190482231 AGCCCATTATAAACCCAAGGTGG + Intergenic
968496696 4:921939-921961 TGCAAATCAAAACCACAAGGAGG + Intronic
969368038 4:6711182-6711204 TGCAGATGAAAACCACAATGAGG + Intergenic
973933903 4:55822379-55822401 TGACCATGCAAACCCTAAGGTGG - Intergenic
974487612 4:62525223-62525245 AGCCCATGAAAACAGCCAGGAGG + Intergenic
974494908 4:62614617-62614639 AGCCCATGAAAGCACCCAGGAGG - Intergenic
978062046 4:104351055-104351077 GGCACTTGACAACCCCAAGGAGG - Intergenic
978153475 4:105464100-105464122 AGCCCATGAAAGCAGCAAGGAGG + Intronic
978756106 4:112304462-112304484 TGCAAATGAAAACCACAATGAGG - Intronic
979666512 4:123316862-123316884 TGGCCAGGAAGACCACAAGGAGG + Exonic
981360911 4:143844766-143844788 TGCCCATGCAAACTCCAGGCTGG + Intergenic
981371650 4:143965757-143965779 TGCCCATGCAAACTCCAGGCTGG + Intergenic
981380739 4:144068966-144068988 TGCCCATGCAAACTCCAGGCTGG + Intergenic
982279186 4:153666358-153666380 AGCCCATGAAAACAGCCAGGAGG + Intergenic
984657639 4:182336232-182336254 TTCCCATGAAAACAACATGGAGG - Intronic
985385564 4:189443919-189443941 TGCCCCAGAAAACCACATGGGGG + Intergenic
985746124 5:1648990-1649012 TGCACATCAAAACCACAATGAGG + Intergenic
987511636 5:18847436-18847458 AGCCCATGAAAACAGCCAGGAGG - Intergenic
989491716 5:42063172-42063194 TGCAAATGAAAACCACAATGAGG + Intergenic
989708597 5:44369124-44369146 TACTCATGAAACACCCAAGGTGG + Intronic
990335243 5:54765979-54766001 TCCCCATAAAAACCCCTAAGAGG + Intergenic
992600838 5:78397875-78397897 TGCAAATGAAAACCACAAGGAGG + Intronic
997085520 5:130793234-130793256 TGCCAATCAAAACCACAATGAGG + Intergenic
999668078 5:153934258-153934280 CGCCCATGAAAGCCGCCAGGAGG - Intergenic
999669322 5:153944906-153944928 AGCCCATGAAAACAGCCAGGAGG - Intergenic
1001994122 5:176141673-176141695 TTGCCATGGAAACACCAAGGGGG - Intergenic
1004982787 6:21045185-21045207 TGACCATAAAAACCCAAAGAAGG - Intronic
1006414040 6:33893008-33893030 TGCCCCTGCCAACCCCGAGGGGG - Intergenic
1007185969 6:39972536-39972558 AGCCCATGAAAGCAGCAAGGAGG + Intergenic
1008003564 6:46386296-46386318 TGCAAATCAAAACCACAAGGAGG + Intronic
1009076936 6:58715829-58715851 TTCCAATGAAAGCCTCAAGGCGG - Intergenic
1009295703 6:61943934-61943956 TGCAAATGAAAACCACAATGAGG + Intronic
1010604662 6:77873315-77873337 TGCCAATCAAAACCACAATGAGG - Intronic
1010980766 6:82365816-82365838 TGTCCAGGAAAACCCTAATGTGG - Exonic
1011216232 6:85008791-85008813 TCCCCATGACAACACCAAGGGGG - Intergenic
1012928629 6:105293948-105293970 TACCCATGAAAATACAAAGGGGG - Intronic
1013947274 6:115736272-115736294 AGCCCATGAAAACAGCCAGGAGG + Intergenic
1014621647 6:123674695-123674717 AGCCCATGAAAACAGCGAGGAGG - Intergenic
1014730910 6:125030709-125030731 AGCCCATGAAAACAGCCAGGAGG - Intronic
1015554266 6:134444550-134444572 CGACTATGAAAACCACAAGGAGG - Intergenic
1015814050 6:137189974-137189996 TCACCATGACAGCCCCAAGGGGG + Intergenic
1018060805 6:160088204-160088226 TGCCCATGAAAACCCCAAGGAGG - Intronic
1023270874 7:38461235-38461257 TGTCCATGAAAGTCCCATGGTGG - Intronic
1024628581 7:51229496-51229518 TGCCCTGGAAAACTCCAAGAAGG - Intronic
1024852341 7:53734514-53734536 TGCCAATTAAAACCAGAAGGAGG - Intergenic
1026166945 7:67918607-67918629 TGCCCATGAAAACCCAGAAATGG - Intergenic
1026686775 7:72516993-72517015 TGCACATTAAAACCACAATGAGG - Intergenic
1027351791 7:77319325-77319347 TGCACATCAAAACCACAATGAGG + Intronic
1028301390 7:89205696-89205718 TGCCCATGAAAACAGCCAGGAGG - Intronic
1029527659 7:101104862-101104884 TCCCCATCTAAACACCAAGGAGG - Intergenic
1030068658 7:105679750-105679772 TGCCCCTGACAACCACAAGTCGG - Intronic
1030172615 7:106619079-106619101 TTTCCTTGAAGACCCCAAGGTGG - Intergenic
1031792035 7:126118423-126118445 AGCCCATGAAAACAACCAGGTGG + Intergenic
1032250838 7:130256089-130256111 GGCCCTTGTAAAGCCCAAGGAGG + Intergenic
1032661725 7:133991129-133991151 TGCAAATAAAAACCACAAGGGGG - Intronic
1034384884 7:150732735-150732757 AGCCCCCCAAAACCCCAAGGTGG - Intronic
1034718318 7:153264153-153264175 AGCCCATGAAAGCAGCAAGGAGG - Intergenic
1035414403 7:158670750-158670772 TGGCCATGAAAAGAACAAGGAGG - Intronic
1036226614 8:6964296-6964318 TTCACATGAAATCCCAAAGGAGG + Intergenic
1036229365 8:6986372-6986394 AGCCCATGCAGATCCCAAGGAGG - Intergenic
1036231817 8:7005476-7005498 AGCCCATGCAGATCCCAAGGAGG - Intronic
1038467314 8:27775978-27776000 TACCCAGGAAAAGCCCCAGGGGG + Intronic
1045488308 8:102651404-102651426 TGCCCATGAACACAACAGGGGGG + Exonic
1045713251 8:105011325-105011347 GGCCCTTGTAAAGCCCAAGGAGG + Intronic
1046157992 8:110319166-110319188 TTCTCATGAAGACTCCAAGGGGG + Intergenic
1046264520 8:111813983-111814005 AGCCCATGAAAACAGCCAGGAGG - Intergenic
1048490903 8:134892863-134892885 TGCCCAGGAAAGACCCAAGTGGG - Intergenic
1049502075 8:142972346-142972368 CGCACATTAAAACCACAAGGAGG + Intergenic
1051702512 9:19839169-19839191 TGCAAATGAAAACCACAATGAGG + Intergenic
1051946276 9:22573278-22573300 AGCCCATGAAAACACCTGGGAGG + Intergenic
1053111969 9:35468923-35468945 CTCCCTTGAAAATCCCAAGGAGG + Intergenic
1055196030 9:73595176-73595198 TGGCCAAGAAAACACCCAGGGGG + Intergenic
1055345580 9:75333804-75333826 TGCCGATCAAAACCACAAGGTGG + Intergenic
1055960112 9:81812359-81812381 TGCCCATGATAGCCCCAAATTGG + Intergenic
1056456618 9:86766651-86766673 TACCCAAGAAAAGCGCAAGGGGG - Intergenic
1056732711 9:89179661-89179683 TGCACATCAAATCCACAAGGAGG + Intergenic
1056902490 9:90612937-90612959 TGGCGATGAACACCCGAAGGTGG - Exonic
1057316421 9:93971730-93971752 TGCCCATGAAAGCAGCCAGGAGG - Intergenic
1058638514 9:107060065-107060087 TCCCCATCAAAAAGCCAAGGTGG - Intergenic
1058804402 9:108577159-108577181 AGCCCATGGAAACACCATGGTGG - Intergenic
1059176437 9:112173735-112173757 TGCCCTCATAAACCCCAAGGAGG - Intronic
1059218344 9:112588704-112588726 TGCCCATGAGATTCCCAAGCTGG + Intronic
1060183990 9:121552711-121552733 TGACCATGGGAGCCCCAAGGAGG - Intergenic
1060931554 9:127492375-127492397 TGCTCTTGGAAACCCCATGGGGG - Intronic
1186940657 X:14503751-14503773 TGCGCATGAGAACCTCCAGGAGG + Intergenic
1187933537 X:24314556-24314578 TCCACATGAACACCCCCAGGCGG - Intergenic
1188052929 X:25509208-25509230 TGCCCATGAAAGCAGCCAGGAGG - Intergenic
1188406287 X:29814297-29814319 TGCAAATCAAAACCACAAGGAGG - Intronic
1189933243 X:46037294-46037316 TTCCCATACAAATCCCAAGGTGG + Intergenic
1190485557 X:50920336-50920358 TGCAAATCAAAACCACAAGGAGG - Intergenic
1192090385 X:68149036-68149058 TGCCCATGAAAGCCATAATGTGG + Intronic
1192379242 X:70598292-70598314 TGCACATCAAAACCACAATGAGG + Intronic
1192404249 X:70868305-70868327 TGCAAATGAAAACCACAATGAGG + Intronic
1192630914 X:72777325-72777347 TGCCCAAGAAACCCCCACGGGGG + Intronic
1192650795 X:72943476-72943498 TGCCCAAGAAACCCCCACGGGGG - Intronic
1194968951 X:100321482-100321504 TGCAAATGAAAACCACAATGCGG - Intronic
1197658945 X:129149116-129149138 TGCCCATGTCAACCACAAAGCGG + Intergenic
1198535993 X:137587232-137587254 TGCCAATGAAAACTACATGGAGG - Intergenic
1199043260 X:143139403-143139425 AGCCCATGAAAGCAGCAAGGAGG + Intergenic
1200043376 X:153386616-153386638 AGCAGATGAAAACCACAAGGAGG - Intergenic
1200672686 Y:6112937-6112959 AGCCCATGAAAACAGCCAGGAGG + Intergenic
1200757507 Y:7003673-7003695 TGCCTATGAAAAACACAAGGAGG - Intronic
1200864406 Y:8027280-8027302 TGCAAATCAAAACCACAAGGAGG - Intergenic
1200914561 Y:8560086-8560108 TGCCTATGAAAACCCAATGTGGG - Intergenic
1201631610 Y:16076568-16076590 TGCACTGCAAAACCCCAAGGAGG + Intergenic