ID: 1018062637

View in Genome Browser
Species Human (GRCh38)
Location 6:160102676-160102698
Sequence GCGGGTGGCAGGGCGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 640}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018062622_1018062637 24 Left 1018062622 6:160102629-160102651 CCTGCTGCCTGCTGGCCCTGTTG 0: 1
1: 0
2: 6
3: 58
4: 403
Right 1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG 0: 1
1: 0
2: 3
3: 52
4: 640
1018062623_1018062637 17 Left 1018062623 6:160102636-160102658 CCTGCTGGCCCTGTTGCTCTACA 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG 0: 1
1: 0
2: 3
3: 52
4: 640
1018062625_1018062637 9 Left 1018062625 6:160102644-160102666 CCCTGTTGCTCTACAAGAAGGAG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG 0: 1
1: 0
2: 3
3: 52
4: 640
1018062626_1018062637 8 Left 1018062626 6:160102645-160102667 CCTGTTGCTCTACAAGAAGGAGA 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG 0: 1
1: 0
2: 3
3: 52
4: 640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018062637 Original CRISPR GCGGGTGGCAGGGCGAGGTG GGG Intronic
900203276 1:1420652-1420674 GTGGGCGGCAGGACGGGGTGGGG - Intronic
900307702 1:2019219-2019241 GCGGGGGGCGGGGGGAGGAGAGG + Intergenic
900402514 1:2478325-2478347 GGGCGGGGCCGGGCGAGGTGAGG + Intronic
900511625 1:3063535-3063557 GTGGGGGGCAGGGCGCGCTGCGG + Intergenic
900593328 1:3469323-3469345 CCGGGTGGCAGGGGCAGGTGGGG - Intronic
900610090 1:3541039-3541061 CCAGGTGTCAGGGCGGGGTGGGG + Intronic
900610737 1:3543572-3543594 GCGGGAGGCGGGGCGAGGCCAGG + Intronic
900619372 1:3579970-3579992 GGGTGAGGCAGGGGGAGGTGAGG + Intronic
900700776 1:4047469-4047491 GAGGGTGGCAGGGAGAGGAAGGG + Intergenic
901023812 1:6268747-6268769 GCGTGTGGCTGGCAGAGGTGAGG - Intronic
901452754 1:9345889-9345911 GCAGTTGGCAGGGTGAGGGGTGG + Intronic
901479994 1:9518621-9518643 GAGGGAGGCAGGGTGTGGTGGGG - Intergenic
901667567 1:10835365-10835387 GCGGGAGGCCGGGCAAGGGGAGG + Intergenic
902517500 1:16997205-16997227 GCTGGTGGGAGGGAGGGGTGTGG - Intronic
902584209 1:17428073-17428095 GCGAGTGGCAGGGCCAGGGTTGG - Intronic
902679828 1:18035316-18035338 AGGGGTGGAAGGGCGTGGTGGGG + Intergenic
902916762 1:19644351-19644373 GCGGCCGGCAGGGCGGGGGGCGG - Intronic
903661517 1:24981580-24981602 GCAGGGGGCAGGGCGGGGTGGGG - Intergenic
903957457 1:27035215-27035237 GGGGGTGGAAGGGGGAGATGAGG - Intergenic
904013871 1:27405903-27405925 GCTGGGGGCAGGAGGAGGTGGGG - Exonic
904391493 1:30189145-30189167 GGGGAGGGCAGGGCCAGGTGGGG - Intergenic
904623477 1:31789304-31789326 GCGGGGGGTGGGGCGAGGTGCGG - Intergenic
904842085 1:33379339-33379361 GGGGGGGGCAGGGGGCGGTGGGG - Intronic
904958650 1:34311866-34311888 GAGGGTGGAAGGGGGAGGAGGGG + Intergenic
905292066 1:36928640-36928662 GAGGGTTGCAAGGCAAGGTGTGG - Intronic
905863873 1:41366473-41366495 GCGGGGAGCAGAGCGGGGTGGGG - Intronic
906083125 1:43107489-43107511 GCGGGGGGCAGGGGGTGGTGGGG + Intergenic
906468425 1:46105752-46105774 TGGGGTGGAAGGGGGAGGTGGGG + Intronic
906535845 1:46550531-46550553 GCGGGGGGTGGGGTGAGGTGAGG + Intronic
906798807 1:48718602-48718624 CCTGGTGGGAGGGAGAGGTGGGG + Intronic
908019205 1:59882467-59882489 GGGGGTTGCAGGGCAAGGGGAGG - Intergenic
908415463 1:63909137-63909159 GCAGGGGGCAGGAGGAGGTGAGG - Intronic
908796270 1:67833506-67833528 GCGGGAGGCAGGGCCCGGCGCGG - Intergenic
908806337 1:67936952-67936974 GGGGGTGGGAGGGTGTGGTGGGG + Intergenic
910101399 1:83582328-83582350 GCGAGTGGTAGGGGGAGGGGAGG + Intergenic
910243663 1:85115691-85115713 CTGGGTGGCAGGGGGAGGTGGGG + Intronic
911798115 1:102099623-102099645 CCGGTTGGCAGGTCCAGGTGGGG - Intergenic
912188092 1:107304877-107304899 GGGGGTGGCAGGGCTAGGGGAGG - Intronic
912937541 1:114016758-114016780 GGGGGAGGCAGGCTGAGGTGCGG + Intergenic
914916098 1:151820134-151820156 GCAGGTGGCAGGGGAAGGAGGGG - Intronic
915128960 1:153683995-153684017 GGGAATGGCAGGGCGAGGGGAGG + Intronic
915495880 1:156282502-156282524 CCGGGTGTCGGGGTGAGGTGCGG - Intronic
915572447 1:156751785-156751807 GCGGGAGGGAGCGCGAGGTTGGG - Intronic
916133633 1:161632423-161632445 GTGTGTGGCAGGGGGAGGGGTGG - Intronic
916686519 1:167152248-167152270 GAGGGTAGCATGGCGGGGTGTGG - Intergenic
916773985 1:167940381-167940403 GCGGGGGGCAGGGTGAGGCAGGG + Intronic
916911655 1:169355504-169355526 GAGGGTGGCAGAGGCAGGTGAGG - Intronic
917375554 1:174349031-174349053 GCGGCTGGCCGGGCGGGGGGGGG + Intronic
917906627 1:179591917-179591939 GCTGGCGTCAGGGCGCGGTGGGG + Exonic
918123328 1:181558630-181558652 GAGGGTGGCAGGCGGAGGCGTGG + Intronic
918142788 1:181732774-181732796 GCAGGAGGCAGGGGGAGGAGAGG + Exonic
918627958 1:186680295-186680317 GCGGCGGGCAGGGCGCGGCGCGG + Exonic
919971356 1:202581554-202581576 GCAGGTGTCAGGGCGAAGAGAGG - Exonic
920745459 1:208623827-208623849 GAGGGTGGCAGAGGGAGGTGCGG + Intergenic
921882680 1:220272372-220272394 GGAGGGGGCAGGGCGTGGTGAGG - Exonic
923548157 1:234939966-234939988 GCTGGTGGCTGGAAGAGGTGAGG - Intergenic
923929255 1:238674804-238674826 GCTGGTGACAGGGAGAAGTGGGG - Intergenic
924289646 1:242524499-242524521 GAAGGAGGGAGGGCGAGGTGCGG + Exonic
924610888 1:245572911-245572933 GCAGGTGGCAGGAGGAGGTGAGG - Intronic
1063127684 10:3150111-3150133 GAGGGTGGCAGGGCCTGTTGGGG - Intronic
1063298273 10:4827473-4827495 GCTGGGGGCTGGGGGAGGTGAGG - Intronic
1063371879 10:5527529-5527551 GAGAGTGGCAGGGAGGGGTGGGG - Intergenic
1063637153 10:7793400-7793422 ACAGATGGCAGGGCCAGGTGCGG - Intronic
1064729639 10:18317099-18317121 GTGGGGGGCAGGGGGTGGTGTGG - Intronic
1065023578 10:21520455-21520477 GGGGGTGGGAGGGCGAGGGCTGG - Intronic
1065588507 10:27242103-27242125 CCGCGGGGCAGGGCGAGGGGCGG - Intronic
1066145505 10:32553940-32553962 GGTGGGGGCAGGGCTAGGTGTGG + Intronic
1067096527 10:43305033-43305055 GCGGGGGGCGGGGAGCGGTGCGG - Intergenic
1067293301 10:44959732-44959754 GCGAGGGGCGGGGCGAGGGGCGG + Intronic
1068869478 10:61928010-61928032 GCGGGAGGAAGGGAGAAGTGTGG + Intronic
1068962221 10:62878038-62878060 GGTGGGGGCAGGGTGAGGTGGGG - Intronic
1069076522 10:64043195-64043217 AAGGGTGGGAGGGCGTGGTGGGG - Intergenic
1069640531 10:69952661-69952683 GTGGGTGGGAGGGGGAGGGGAGG - Intronic
1069651668 10:70053605-70053627 CCGGGTGGCGGGGCGAGGGCTGG + Intronic
1069824817 10:71248396-71248418 GCGGGAGGCAGGGAGAAGGGGGG + Intronic
1070811851 10:79302043-79302065 GCTGCAGGCAGGGCGGGGTGTGG + Intronic
1071579665 10:86757153-86757175 GCGGGTTGCAGGCCGAGTTTGGG + Intronic
1071869229 10:89774813-89774835 GACGGTTGCAGGGGGAGGTGGGG - Exonic
1072453867 10:95560071-95560093 GCGGGGGGCTGGGCGGGGGGGGG + Intronic
1072535586 10:96360265-96360287 GGGCGGGGAAGGGCGAGGTGAGG + Intergenic
1072549773 10:96468741-96468763 GTGGGGTGCAGGGCCAGGTGGGG - Intronic
1073268319 10:102241496-102241518 GGGGGTGGCAGTACGCGGTGAGG - Intergenic
1073403458 10:103277129-103277151 GCGGCAGGCAGGGCGCGGCGGGG - Intergenic
1073458811 10:103653806-103653828 GAGGGTGGCAGGCACAGGTGTGG - Intronic
1073468905 10:103710731-103710753 GGGGATGGCAGGCCCAGGTGTGG + Intronic
1075012614 10:118887558-118887580 GCTGGTGGCAGGGGGTGGTGTGG - Intergenic
1075206399 10:120453159-120453181 GCGGGTGGCAGGTGGCGGGGTGG + Intergenic
1075627021 10:123970806-123970828 GCAGGGGGCAGGGCAAGGTAGGG - Intergenic
1076071372 10:127492595-127492617 GCGGGGGGCGGGGGGCGGTGGGG + Intergenic
1076323794 10:129604720-129604742 GGGGGTGGGGCGGCGAGGTGGGG - Intronic
1076659769 10:132047867-132047889 GCGGGGGGCGGGGCGGGGGGTGG - Intergenic
1076737487 10:132465305-132465327 GGGGATGGCAGGGCAGGGTGGGG - Intergenic
1076883851 10:133252424-133252446 GCGGGGTGCAGGGCGGGCTGGGG - Intergenic
1076923043 10:133465446-133465468 CCGTGTGGCTGGACGAGGTGGGG + Intergenic
1076981756 11:208523-208545 GTGTGTGGCAGGGCACGGTGGGG + Exonic
1077263774 11:1638555-1638577 GAGTGTGGCAGGGTCAGGTGAGG - Intergenic
1077502150 11:2914289-2914311 GCGTCTGGCAGGTCGTGGTGAGG + Intronic
1078043805 11:7894200-7894222 AGGGGTGGCAGGGAGAGGAGTGG - Intergenic
1078929318 11:15901211-15901233 GCGGGTGGGAGGGCCAGCAGAGG + Intergenic
1080275280 11:30496709-30496731 GCGGGGGGTGGGGGGAGGTGAGG + Intronic
1080779677 11:35419078-35419100 GCGGGTGGAAGGGCGGGCAGAGG - Exonic
1080914143 11:36638136-36638158 GCGGGCGGTGGGGCGGGGTGTGG - Intronic
1083033567 11:59615771-59615793 GCGGCTGGCCGGGCGGGGCGGGG - Exonic
1083298017 11:61725721-61725743 GTGGGTGGAAGAGAGAGGTGGGG - Intronic
1083675095 11:64320781-64320803 GCGGAAGGCAAGGTGAGGTGAGG + Exonic
1083768551 11:64853847-64853869 GGGGGAGGCAGAGCCAGGTGAGG + Exonic
1084031628 11:66484662-66484684 GTGGGTGGGAGGGTGGGGTGGGG - Intronic
1084045357 11:66564860-66564882 GTGAGGGGCAGGGTGAGGTGAGG - Intronic
1084383036 11:68825695-68825717 GAGGCTGGCTGGGTGAGGTGGGG - Intronic
1084484365 11:69439250-69439272 GAGGCTGGGAGGGCCAGGTGTGG - Intergenic
1084490613 11:69476363-69476385 GCCGGTGCCAGGGCTGGGTGGGG - Intergenic
1084502365 11:69542328-69542350 GCGGGGGACGGGGGGAGGTGAGG + Intergenic
1084561648 11:69908993-69909015 GCTGGTGCCAGGGTGAGGCGAGG + Intergenic
1084717436 11:70882913-70882935 GCAGGAGGCAGGTGGAGGTGAGG + Intronic
1084727043 11:70948664-70948686 GCGGGCTGCAGGGAGCGGTGGGG + Intronic
1086480923 11:87237796-87237818 GTGGGGAGCAGGGGGAGGTGGGG - Intronic
1087215030 11:95484415-95484437 GCAGGGGGCAGGGGGAGGTAGGG - Intergenic
1087290264 11:96313508-96313530 TGGGGAGGCTGGGCGAGGTGGGG - Intronic
1087360957 11:97158732-97158754 GCGGGAGGCAGAGGGAGGGGGGG - Intergenic
1088089871 11:106024970-106024992 GGGGGTGGGGGGGGGAGGTGAGG + Intergenic
1088818197 11:113435495-113435517 GTGGGAGGCAGGTGGAGGTGTGG + Intronic
1088890365 11:114039339-114039361 GCAGGTGACAGGGCCAGGTGGGG - Intergenic
1089130107 11:116205576-116205598 GAAGGTGGCAGAGGGAGGTGAGG - Intergenic
1089329095 11:117677473-117677495 GCAGGGGGCAGGGAGAGGGGAGG + Intronic
1089537410 11:119169098-119169120 GCGGGGGGCAGGGCGGGCCGGGG + Exonic
1089540770 11:119187969-119187991 GCTGGTGGCAGGGCCAGAGGTGG + Exonic
1090190134 11:124761861-124761883 GCGGATGGCGGGGGGAGGTAAGG - Intronic
1090989821 11:131806646-131806668 GCTAGTGGCAGAGCGAGGAGTGG + Intronic
1091643941 12:2259226-2259248 GTGTGGGGCAGGGCGGGGTGTGG - Intronic
1092810511 12:12267383-12267405 GCCGCCGGCAGGGCCAGGTGGGG + Intergenic
1093077363 12:14771688-14771710 GCGGGGGTCGGGGGGAGGTGGGG - Intergenic
1093642537 12:21543736-21543758 TCGGGTTGTGGGGCGAGGTGAGG - Intronic
1093753718 12:22829886-22829908 GCGTGTGGAAGGGCAATGTGGGG + Intergenic
1096109675 12:49021307-49021329 CCGGCAGGCAGGGCCAGGTGTGG + Exonic
1096156932 12:49346210-49346232 GGGGGCGGCAGGGCGGGGGGAGG - Intergenic
1096159903 12:49367571-49367593 GCGGGGGCCTGGGCTAGGTGAGG + Exonic
1096651131 12:53062477-53062499 GCAGGGGGTAGGGAGAGGTGGGG - Intronic
1097127987 12:56789485-56789507 GCGGCTGGCCGGGCGGGGGGGGG + Intergenic
1097284262 12:57865442-57865464 GCGGCTGGCCGGGCAAGGCGGGG + Intergenic
1098141185 12:67451577-67451599 GTGGGTGGGAGGAGGAGGTGGGG - Intergenic
1098499140 12:71170202-71170224 AGGGGTTGCAGGGAGAGGTGGGG + Intronic
1099942644 12:89207116-89207138 GGGGTTGGCAGGGAGAGGAGAGG - Intergenic
1101365854 12:104069841-104069863 GGGGGTTGCAGGGCAAGGGGAGG - Intronic
1101606075 12:106248203-106248225 GGGGGTGGCTGGGCGCGGGGCGG + Intronic
1102036560 12:109773651-109773673 GCGAGTGGCAGGGGGAGGGGAGG + Intergenic
1102134084 12:110558242-110558264 GCGGCTGGCAAGGCAAGTTGGGG + Intronic
1102260077 12:111438160-111438182 CTGGGTGGCAGGGGAAGGTGTGG + Intronic
1102310651 12:111842222-111842244 GCGGGTGTCCCGGCGATGTGTGG + Intronic
1103314820 12:120044303-120044325 GGTGGTGGCGGGGTGAGGTGGGG + Intronic
1103749620 12:123150379-123150401 GCCGGTGCCAGGGCGAGGAAGGG - Intergenic
1104761505 12:131299787-131299809 GCGGGTGGGAAGGCGATTTGAGG + Intergenic
1104818271 12:131661005-131661027 GCGGGTGGGAAGGCGATTTGAGG - Intergenic
1104894985 12:132159605-132159627 GGGCGTGGAAGGGCGGGGTGTGG + Intergenic
1104930649 12:132337693-132337715 GCGGGTGACGTGGCGACGTGTGG + Intergenic
1105617104 13:22028903-22028925 GCGGGAGGGAGGGTGTGGTGCGG + Intergenic
1106370687 13:29129853-29129875 GGTGGGGGCAGGGTGAGGTGAGG + Intronic
1106457296 13:29938408-29938430 GCAGGTGGGAGGGCGAGATCAGG - Intergenic
1106458707 13:29949385-29949407 GAGGATGGCAGAGCAAGGTGGGG - Intergenic
1106512251 13:30421925-30421947 GCGGGGAGGAGGGAGAGGTGGGG + Intergenic
1107830217 13:44368401-44368423 GGGGGTGGCGGGGCGGGGTGAGG + Intergenic
1108363795 13:49691181-49691203 GGGGGCGGCAAGGCGGGGTGAGG - Intronic
1110175124 13:72547105-72547127 GCAGGTGGCAGAGTGAGGTATGG + Intergenic
1110727641 13:78843751-78843773 GTGGGTGGCAGGGGGTGGCGGGG - Intergenic
1110822636 13:79934424-79934446 GCGGGTGGGAGGCTGAGGTCAGG - Intergenic
1112326638 13:98446244-98446266 GGGGGTGGCAGCATGAGGTGAGG + Intronic
1113512483 13:110867220-110867242 GCCTGTGGCATGGGGAGGTGTGG - Intergenic
1113759661 13:112838520-112838542 GCGTGTGGCAGGGCCAGCTCCGG - Intronic
1113766317 13:112882944-112882966 GCGGGAGGCGGGCAGAGGTGCGG - Exonic
1113841574 13:113364197-113364219 GGGGGGGGCAGGGCGGGGGGAGG + Intergenic
1113885688 13:113657307-113657329 AGGGGTCGCAGGGGGAGGTGGGG + Intronic
1115174567 14:30547609-30547631 GCGGGTGGCAGGGGGGGCTTAGG + Intergenic
1115761672 14:36582667-36582689 GCGGGGTGCGGGGCGGGGTGCGG - Intergenic
1116426569 14:44798866-44798888 GCGGGGGGGCGGGGGAGGTGGGG - Intergenic
1118309681 14:64683226-64683248 ACGGGAAGCAGGCCGAGGTGGGG - Intergenic
1118857269 14:69633404-69633426 GCGGGTGGCAGGGTAAGGTCGGG - Intronic
1119046102 14:71320405-71320427 GCGGGAGGCGGGGCGGGGAGGGG + Intergenic
1119484386 14:74978401-74978423 GCGCCTGGCCTGGCGAGGTGCGG - Intergenic
1121010559 14:90517759-90517781 GCGGGTGGCAGGGAGTGGCTGGG - Intergenic
1121224286 14:92309835-92309857 ACGAGTGGCCGGGAGAGGTGAGG + Intergenic
1122266510 14:100549315-100549337 GTGGGTGGCTGGACGTGGTGAGG - Intronic
1122275184 14:100587388-100587410 GCGGGAAGCCGGGCGGGGTGGGG - Intronic
1122316487 14:100828501-100828523 GAGGGGGGCAGGGAGAGGGGAGG - Intergenic
1122817266 14:104319889-104319911 GCGGGCCGCAGGGCGGAGTGTGG + Intergenic
1123015426 14:105371651-105371673 GCAGGGGGCAGTGCCAGGTGTGG - Intronic
1123066577 14:105622233-105622255 GTGGGGGACAGGGAGAGGTGGGG + Intergenic
1123066602 14:105622315-105622337 GTGGGTGACAGGGAGAGGTGGGG + Intergenic
1123072100 14:105646949-105646971 GTGGGTGGCAGGACGAGTAGGGG - Intergenic
1123093301 14:105751654-105751676 GGGGGTGGGAGGACGTGGTGTGG + Intergenic
1123857392 15:24427104-24427126 GCGGGAGCCAGGCCCAGGTGGGG + Intergenic
1123973368 15:25529581-25529603 GCCTGTGGCAAGGCCAGGTGTGG + Intergenic
1124533583 15:30525644-30525666 GTGGGTGGCTCGGCGAGGTTTGG - Intergenic
1124646581 15:31441258-31441280 GTGGGTTGCGGGGGGAGGTGCGG - Intergenic
1124765072 15:32482001-32482023 GTGGGTGGCTCGGCGAGGTTTGG + Intergenic
1126756985 15:51934606-51934628 GCTGTAGGCAGGGCCAGGTGTGG - Intronic
1127326034 15:57896250-57896272 GCGGGGGGGGGGGGGAGGTGCGG - Intergenic
1127395284 15:58539693-58539715 GTGGGAGGCAGGGAGAGGTGAGG - Intronic
1127893754 15:63277399-63277421 GTGGGTCGCGGGGCGAGGCGGGG - Intronic
1127931900 15:63602289-63602311 GAGGGTAGAAGGGCCAGGTGCGG + Exonic
1128392000 15:67188605-67188627 GCGGCTGGCAGGGGGGAGTGTGG - Intronic
1129274087 15:74434015-74434037 GCGGGGGGAGGGGCGGGGTGGGG - Exonic
1129488859 15:75904092-75904114 GCGGGTGGCCTGGTGAGGAGAGG + Exonic
1129852271 15:78800257-78800279 GCAGGTGGCAGGCCGGGGTGTGG + Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130115286 15:81000865-81000887 GCGGGAGGAAGGGCGAGAGGAGG + Intergenic
1130250727 15:82298816-82298838 GCAGGTGGCAGGCGGGGGTGTGG - Intergenic
1131116509 15:89799392-89799414 GCAGGGGGCAGGGCGAGGGGTGG + Intronic
1131179115 15:90228233-90228255 GCTGGTGGCAAGGCCAGCTGGGG + Exonic
1132314381 15:100879673-100879695 GCGGCGGGCGGGGCGGGGTGAGG + Exonic
1132583056 16:694133-694155 GCGGGAGGCGGGGCGAGCCGAGG - Exonic
1132633173 16:929483-929505 GCGGGTGGCAGGGCTCCGTGGGG - Intronic
1132683476 16:1153078-1153100 GCGGGGGGCGGGGCGGGGCGGGG - Intergenic
1133950511 16:10387827-10387849 CCGGGTGGCGGGGGGAGGGGGGG - Intronic
1135552463 16:23408444-23408466 GCGAGTGGCGGGGGGAGGTGGGG + Intronic
1136553264 16:30992980-30993002 GAGGGTGGCAGGGAGAAGAGGGG + Intronic
1136631099 16:31489693-31489715 GATGGTGGCAGGGTGGGGTGAGG + Exonic
1136751247 16:32637879-32637901 GGTGCTGGCAGGGCCAGGTGTGG + Intergenic
1136777425 16:32879380-32879402 GGGGGGGGCGGGGCGGGGTGGGG - Intergenic
1137534261 16:49305731-49305753 GAGGGGGGAAGGGGGAGGTGAGG - Intergenic
1137535236 16:49316635-49316657 GAGAGAGACAGGGCGAGGTGGGG + Intergenic
1137934749 16:52623940-52623962 GAGGGTGGCAGGGGGTGATGTGG + Intergenic
1138143724 16:54589680-54589702 GGGTGGGGCAGGGCGGGGTGGGG + Intergenic
1138242977 16:55443991-55444013 TTGGGTGGCAGGGGGAGGGGAGG + Intronic
1138392758 16:56682390-56682412 GCGGGTGCAAGGACGAGGCGGGG + Intronic
1138517375 16:57543655-57543677 GTGGTTGGCAGGGGCAGGTGGGG + Intronic
1138839496 16:60482576-60482598 GCTGGGGGCAGGGAGAGATGAGG - Intergenic
1140328082 16:74025304-74025326 GCAGGGGGCTGGGGGAGGTGAGG - Intergenic
1140406205 16:74713358-74713380 CTGGGAGGCAGGGGGAGGTGAGG + Exonic
1140855708 16:78975917-78975939 GAGGGTGGCAGGGCAAAGGGTGG - Intronic
1140858266 16:78996947-78996969 GCGCCTGGGAGGGCGAGGTGCGG + Intronic
1141558066 16:84849157-84849179 GAGGGAGGGAGGCCGAGGTGGGG - Intronic
1141657180 16:85422458-85422480 GCGGGAGGCAGTGTGGGGTGGGG + Intergenic
1141662482 16:85448959-85448981 GCGGGTGGAGGGGCGGGGAGAGG - Intergenic
1141746287 16:85928736-85928758 CTGGGTGGCAGGACGGGGTGGGG + Intergenic
1142007283 16:87695514-87695536 GCGAGATGCAGGGCGTGGTGGGG + Intronic
1142112260 16:88339178-88339200 CAGGGTGGCAGGGGGATGTGGGG + Intergenic
1142150998 16:88512538-88512560 CTGGGGGGCAGGGCGGGGTGGGG - Intronic
1142195475 16:88737438-88737460 GGGGGCGGCAGGCAGAGGTGCGG + Intronic
1142395277 16:89828383-89828405 GCGGGGGGCGGGGCGCGGAGGGG - Intronic
1203053381 16_KI270728v1_random:897134-897156 GGTGCTGGCAGGGCCAGGTGTGG + Intergenic
1203079838 16_KI270728v1_random:1141489-1141511 GGGGGGGGCGGGGCGGGGTGGGG - Intergenic
1143404919 17:6671073-6671095 GCGGGAGGCAGGCAGAGGTGTGG - Intergenic
1143473678 17:7191516-7191538 GCGGGTGGCAGGGGGGTGGGGGG - Intronic
1143483168 17:7238643-7238665 GGGGGTGGTGGGGCGGGGTGGGG - Intronic
1143585258 17:7847657-7847679 CCAGGTGGCAGGGATAGGTGGGG - Exonic
1144656822 17:17042410-17042432 GCGGGCGGCCGGGCGCGGGGAGG - Intergenic
1144767579 17:17740956-17740978 GCGGGTGGGAGGGGTGGGTGAGG + Intronic
1144948689 17:18982622-18982644 GCGGGTGGCAAGGCAAGGTGGGG + Intronic
1145241721 17:21244074-21244096 GCAGGTGGCAGGGCCAAGCGGGG - Intronic
1145268484 17:21391883-21391905 GTGGGTGGGAGGGCCAAGTGTGG + Intronic
1145862985 17:28224288-28224310 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1147138447 17:38448211-38448233 GAGGCTGGCAGTGGGAGGTGGGG + Intronic
1147419284 17:40314172-40314194 GCGGGTGGAGGGGTGGGGTGGGG + Intronic
1147419345 17:40314438-40314460 TTGGGTGGCAGGAGGAGGTGGGG + Intronic
1147742999 17:42679300-42679322 GCGCGGGGCAGGGCGGGGGGTGG + Exonic
1147792556 17:43022426-43022448 GCGGGGCGCCGGGCGAGGCGGGG + Intronic
1148081706 17:44970493-44970515 GCGGGAGGCGGGGCGCCGTGTGG - Intergenic
1148477295 17:47937135-47937157 GCTGGTGGCAGGGATAGGTTGGG - Intergenic
1148582450 17:48753039-48753061 GCGGGCGGCAGGGAGAGGGAAGG + Intergenic
1148731040 17:49836819-49836841 GCCGGTGGCTGGGTGGGGTGGGG + Intergenic
1149294413 17:55249050-55249072 GCTGGGGGCTGGGCGAGATGAGG - Intergenic
1149459203 17:56813319-56813341 GGGGGTGGCAGAGCAAGGCGGGG - Intronic
1149541662 17:57472313-57472335 GCAGGGGGCAGGGCGAGCTCAGG + Intronic
1149569988 17:57665593-57665615 GCAGGGGGCAGGGTGGGGTGGGG - Intronic
1149852165 17:60044348-60044370 GCGTGTGGCAGGCTGAGGTAGGG - Intronic
1149994270 17:61398882-61398904 GTGGTTGGCAGGGCGAAGAGAGG + Intergenic
1150069271 17:62138229-62138251 GCGGCGGGCAGGGGTAGGTGCGG + Intergenic
1150161155 17:62899226-62899248 GCCGCTGGCTGGGCGGGGTGTGG + Intergenic
1150833067 17:68541021-68541043 TGGGGGGGCAGGGGGAGGTGTGG - Intronic
1151339290 17:73459409-73459431 GGAGGTGGCAGGACGTGGTGTGG - Intronic
1151349146 17:73521435-73521457 GGGGCTGGCAGGGAGAGGAGGGG - Intronic
1151578315 17:74963739-74963761 GCCCGGGGCAGGGCGAGGAGGGG - Exonic
1151660345 17:75515395-75515417 GCGGGCGGCCGGGAGAGGTGAGG - Exonic
1152008385 17:77696248-77696270 GTGGGGGGAAGGGCGAGGAGGGG + Intergenic
1152068630 17:78124576-78124598 GCGGGTGGGAAGGCGACCTGAGG + Exonic
1152177646 17:78798362-78798384 GTGGGTGTAAGGGTGAGGTGGGG - Intronic
1152217895 17:79045091-79045113 GCTGGAGGCAGGGCCAGGAGAGG + Intronic
1152270553 17:79322220-79322242 GTGGGTGGCAGGGAGAAGAGGGG + Intronic
1152435091 17:80271572-80271594 GTGTGTGTCAGGGAGAGGTGGGG + Intronic
1152450127 17:80373308-80373330 GGGGGTGTGAGGGTGAGGTGTGG - Intronic
1152597016 17:81242656-81242678 GCGGGGGGGAGGGGGAGGGGAGG + Intergenic
1152642147 17:81453792-81453814 GGAGGTGGAAGGGTGAGGTGGGG - Intronic
1152741372 17:82019934-82019956 GCGGGGGGGAGGGCGGGGCGTGG - Intronic
1152748032 17:82050191-82050213 GGGGGTGTCTGGGCCAGGTGGGG - Intronic
1152777642 17:82212774-82212796 GCGGGCGTTAGGGTGAGGTGCGG - Exonic
1152861148 17:82697800-82697822 GCGGGTTCCAGGGCGAGGGGAGG - Intronic
1152910981 17:83004610-83004632 GAGGGTGGGAGGGCGAGCTCAGG - Intronic
1152910992 17:83004653-83004675 GAGGGTGGGAGGGCGAGCTCAGG - Intronic
1153681781 18:7507873-7507895 GTGGGTGGCAGGGCATGATGTGG + Intergenic
1154177272 18:12093703-12093725 GCGGGGGGCGGTGGGAGGTGGGG + Intergenic
1155470792 18:26190153-26190175 GTGGGGGGCAGGGGCAGGTGGGG + Intronic
1156502026 18:37566153-37566175 GCCGGGGGCAGGGCGGCGTGGGG + Intergenic
1157427267 18:47594589-47594611 GGGGGGGCCAGGGGGAGGTGGGG + Intergenic
1157529513 18:48409445-48409467 GCGGGAGGCGGGGCGCGGGGAGG - Intronic
1158458806 18:57630167-57630189 GCGCCTGGTAGGGCGAAGTGGGG - Intergenic
1160699149 19:497772-497794 GCCGGTGGCGGGGCGGGGTCCGG + Intronic
1160720422 19:594705-594727 CCCGGGGGCAGGGCGAGGCGAGG + Intronic
1160726881 19:621264-621286 GCGGCGGGCAGGGGTAGGTGCGG + Exonic
1160806925 19:996008-996030 GCTGGTGCCAGGGCGGGGTGAGG + Intronic
1161017642 19:1991162-1991184 CCGAGTGGCAGGCAGAGGTGAGG + Intronic
1161029425 19:2050911-2050933 GCGGGCGGCCGGGCGGGGGGCGG + Exonic
1161102213 19:2426790-2426812 GCAGGGGGCAGGGCGGGGGGTGG + Exonic
1161201941 19:3019843-3019865 GAGGGTGGCGGGGAGAGGTCAGG - Intronic
1161219570 19:3112275-3112297 GCTGGGGGCAGGGCAAGGGGAGG + Intronic
1161646635 19:5456947-5456969 GCGGGCGGGAGAGCGAGGGGTGG + Intergenic
1161687997 19:5713100-5713122 GCGGGGGACAGTGGGAGGTGGGG - Intronic
1162327181 19:10006250-10006272 GGGGGTGTCAGGCAGAGGTGGGG + Intronic
1162514278 19:11138778-11138800 GCGGCTGCCAGAGGGAGGTGGGG + Intronic
1163148349 19:15397366-15397388 GGAAGTGGCAGGGCGAGTTGAGG - Intronic
1163370319 19:16897643-16897665 GGGTGTGGCAGGCCGCGGTGGGG + Intronic
1163387947 19:17011689-17011711 GCGGCTGGCAGGCGGAGGAGGGG - Exonic
1163552368 19:17972706-17972728 GCAGGAGGCACGGTGAGGTGAGG + Intronic
1163633811 19:18429455-18429477 GCGGGTCGCAGGGGGCGGGGGGG + Intronic
1163651801 19:18522111-18522133 GCGGGCGGCGGGGCGGGGCGTGG - Exonic
1163679062 19:18670137-18670159 GGGAGTGGCAGGGCGCGGAGGGG - Exonic
1164913349 19:32029889-32029911 GCAGGTGGCAGGGGGATGTTAGG - Intergenic
1165073983 19:33270587-33270609 GCATCTGGCAGGGTGAGGTGGGG - Intergenic
1165149175 19:33750904-33750926 GAGGGTTGCAGGGCTGGGTGGGG - Intronic
1165422385 19:35728679-35728701 GCGGGTGTCATGGCGAGTTCAGG + Intronic
1165982312 19:39735097-39735119 GAGAGAGGCAGGGCCAGGTGTGG + Intronic
1166798946 19:45444265-45444287 GCGGCTGGCTGGGGGAGGGGGGG - Intronic
1166895905 19:46021880-46021902 GCAGGTGGCAGGGGGTGCTGGGG - Intronic
1166939890 19:46356137-46356159 GCGGATGGCAGGGAGGGTTGAGG + Intronic
1167055780 19:47111289-47111311 GCGCGTTTCAGGGCGAGGTTGGG - Intronic
1167110460 19:47457604-47457626 GCGGGCGTCAGGGCGAGGCCGGG + Intronic
1167134717 19:47609630-47609652 GCGGGGAGCGGGGCGAGGGGAGG - Intronic
1167203829 19:48086513-48086535 GCGGGTGGCAGGGCAAAGCCAGG - Intronic
1167250899 19:48397997-48398019 GGAGGTGGAAGGGAGAGGTGGGG - Intronic
1167594994 19:50422847-50422869 GGGGGTGGCTGGGACAGGTGGGG - Exonic
1168100862 19:54140245-54140267 GCGGGTGGCGGGGTGGGGGGAGG - Intronic
1168254344 19:55157612-55157634 GCAGGAGGCAGGGCGAGGACAGG + Exonic
925281309 2:2687184-2687206 GGGGGATGGAGGGCGAGGTGAGG + Intergenic
925713786 2:6767033-6767055 GCGGGTGGCGGGGCTAGGGGAGG - Intergenic
925739955 2:6996507-6996529 GAGCTTGGCAGGTCGAGGTGGGG + Intronic
926089984 2:10043498-10043520 GCGGCTGGCGGGGCGGGGCGCGG - Intronic
926095871 2:10080310-10080332 GCGGGCTGCAGGGGGAGGCGCGG + Exonic
926096087 2:10081039-10081061 GGCGGGGGGAGGGCGAGGTGGGG - Intergenic
926267928 2:11343868-11343890 GCCGGAAGCAGGGCGGGGTGGGG + Intronic
926474746 2:13308407-13308429 GCGGTGGGCTGGGCGGGGTGGGG + Intergenic
926735535 2:16070718-16070740 GGGGGTGCCTGGGAGAGGTGGGG - Intergenic
926742717 2:16125885-16125907 GCGGGGAGCAGGGCCAGGTCAGG - Intergenic
927137385 2:20106876-20106898 GCGGGAGGAAGGGAGAGGCGCGG - Intergenic
928149144 2:28810698-28810720 GCGGGGGGCAGGGAGGGGCGGGG + Intronic
928711607 2:34012985-34013007 GCGGGGGGAAGGGTGAGTTGTGG + Intergenic
929940946 2:46333597-46333619 GGGGGTGGCAGGGCATAGTGTGG + Intronic
931622861 2:64228599-64228621 GTGGGTGGCAGGGAGATCTGAGG - Intergenic
932231529 2:70087665-70087687 GCGGCTGGCGGGGGGAGGGGAGG - Exonic
932433428 2:71688867-71688889 CCAGGTGGCAAGGCCAGGTGGGG + Intergenic
932567266 2:72917813-72917835 GCGGGCGGGCGGGGGAGGTGAGG + Exonic
932661547 2:73657533-73657555 GTGGTTGCCAGGGCGAGGCGGGG - Intergenic
932798125 2:74715474-74715496 GCGGCTGGCAGGGCCTGGGGCGG + Intergenic
932820703 2:74897493-74897515 GCGGCGGGGAGGGGGAGGTGGGG - Intergenic
934747354 2:96768251-96768273 GCGGATGGGAGGGTGGGGTGTGG - Intronic
935558830 2:104540377-104540399 GAGGGGGGCAGGGAGAGGAGTGG - Intergenic
935794180 2:106624903-106624925 GAGGGTGGCAGGCAGAGATGAGG - Intergenic
936747981 2:115603324-115603346 GGGGGTGGCGGGGCGGGGGGTGG - Intronic
937049466 2:118876487-118876509 GCAGGTGGCAGGGCTGGGTCAGG - Intergenic
937149943 2:119679356-119679378 GCCGGTGGCTGGGGGAGGAGGGG - Exonic
938017056 2:127876043-127876065 GCGGGTGGGGGGGCGGGGCGGGG - Intronic
939046720 2:137258593-137258615 GTGGGGGGCAGGGCGAGTGGTGG - Intronic
939618392 2:144386911-144386933 GGGGGGGGCAGGGGGAGGAGTGG - Intergenic
939847132 2:147261099-147261121 GGGGGTGGCGGGGGGAGGAGAGG - Intergenic
942150922 2:173075689-173075711 GCGGGTGCCGGGGCGCGGGGCGG + Intronic
942268124 2:174248314-174248336 GCGGGTGGCTTGGGGATGTGTGG - Intronic
943548513 2:189310936-189310958 GTGGGGAGCAGGGGGAGGTGGGG + Intergenic
944271177 2:197786213-197786235 TCGGGTGGCAGGTGGCGGTGCGG + Exonic
944857041 2:203777904-203777926 GCAGGGGGCAGGGCGGGGAGGGG + Intergenic
945119636 2:206443983-206444005 GCAGGCGGCAGGGCGGCGTGCGG - Exonic
946395488 2:219442010-219442032 GCCGGCGGCCGGGCGAGGAGGGG - Intronic
947398838 2:229713560-229713582 GCTGGTCGCAGGCCGAGGGGAGG + Intronic
947527426 2:230886991-230887013 GTGGGAGGCAGGGGGAGGTGGGG + Intergenic
947871409 2:233440883-233440905 GCGGGTGGCTGGGTTGGGTGTGG + Intronic
947877533 2:233477656-233477678 GCTGGTGGCAGGGCAAAATGGGG - Intronic
948046995 2:234952323-234952345 GCGGGTGCCTGGGCGTGGGGCGG + Intronic
948118428 2:235511109-235511131 GCACGTGGCAGGTGGAGGTGAGG + Intronic
948125252 2:235560355-235560377 GAGGGAGGCATGGGGAGGTGAGG - Intronic
948465969 2:238151753-238151775 GAGGGAGGCAGGGCGTGGGGCGG + Exonic
948552860 2:238786272-238786294 GCGGGTGCCAGGGCTGGGGGAGG - Intergenic
948771151 2:240251831-240251853 GCGGGAGGGAGGGAGAGCTGGGG - Intergenic
948794253 2:240394085-240394107 GTGGGTGGCAGGGTGAAGGGAGG - Intergenic
1168766078 20:382031-382053 GCGGGGGGCGGGGCGGGGTGGGG + Intronic
1169365776 20:4991059-4991081 GCGGGTGGGAGGGAGGTGTGAGG + Intronic
1169617412 20:7464510-7464532 GGAGGTGTAAGGGCGAGGTGAGG - Intergenic
1170429795 20:16265519-16265541 GCGGGTGGCAGGTCGTGCTCAGG - Intergenic
1172523109 20:35582107-35582129 GGAGGTGGCTGGGCAAGGTGTGG - Intergenic
1172906976 20:38377693-38377715 GCTGGTGGCAGGGTAAGCTGTGG + Intergenic
1173412317 20:42823387-42823409 AGGGGTGGCAGGGTGAGGGGAGG + Intronic
1173642741 20:44615242-44615264 GAGGGTGTCAGGGAGAGGAGTGG - Intronic
1174406903 20:50308822-50308844 GGGGGTGGCGGGGGGAGGAGGGG - Intergenic
1174485689 20:50859739-50859761 GAGGGGGGCAGGAGGAGGTGGGG + Intronic
1174796490 20:53526920-53526942 GGGGGTGGGAGGGGGAGGTGGGG + Intergenic
1175139778 20:56852421-56852443 ACAGGTGGCAAGGTGAGGTGGGG - Intergenic
1175216736 20:57395231-57395253 GCGGGTGGCAGGGCCAGGGTGGG + Intronic
1175218680 20:57404838-57404860 GCAGGTGCCAGGCCCAGGTGGGG + Intronic
1175647561 20:60687701-60687723 GAGGGAGCCAGGGCGAGTTGGGG + Intergenic
1176115481 20:63430176-63430198 GCGGGCGGCAGGGCCAGGGCAGG + Intronic
1176380924 21:6111666-6111688 TCGGGTGGCAGGGCCAGGTGTGG + Intronic
1176547044 21:8206594-8206616 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
1176554949 21:8250803-8250825 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
1176565995 21:8389641-8389663 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
1176573870 21:8433828-8433850 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
1178213951 21:30571972-30571994 GAGGGTGGCAGGAGGGGGTGGGG + Intergenic
1178314595 21:31558204-31558226 GCTGGTGAGAGGGCGAGGCGGGG + Intronic
1178468512 21:32870839-32870861 GTGGGGGGCAGGGGTAGGTGGGG + Intergenic
1178886566 21:36489566-36489588 GCTGATGGCAGGGCCTGGTGGGG + Intronic
1179553857 21:42160256-42160278 GGGGGTGGCAGGGACAGGAGAGG - Intergenic
1179649524 21:42798421-42798443 GCGGGTGGGAGGGGAGGGTGGGG + Intergenic
1179742548 21:43426574-43426596 TCGGGTGGCAGGGCCAGGTGTGG - Intronic
1179941114 21:44639232-44639254 GAGGGTGGCAGGCAGAGCTGAGG - Intronic
1180014443 21:45073467-45073489 GCGGTGGGCAGAGCCAGGTGTGG - Intergenic
1180041674 21:45283323-45283345 GCATGCGGCAGGGGGAGGTGGGG + Intronic
1180091603 21:45536397-45536419 GTGGGTGGCAGGGAGAGGGACGG + Intronic
1180182873 21:46125647-46125669 GCGGGGGGCCGGGCGGGGCGTGG + Intronic
1180682616 22:17638870-17638892 GCAGGGGCCAGGGCCAGGTGAGG + Exonic
1180960499 22:19760501-19760523 GCGGGCGGCAGAGCGAGGGCCGG + Intronic
1181042993 22:20201634-20201656 GAGAGTGGCAGGGTGAGCTGGGG + Intergenic
1181670608 22:24424033-24424055 GCTGGTGGCCGGGCGGCGTGGGG + Intronic
1181850657 22:25747667-25747689 GAGGCTGGCAGGGTGGGGTGAGG + Intronic
1182080774 22:27527108-27527130 GCGGGTGGGAGGACCTGGTGGGG + Intergenic
1182279588 22:29209982-29210004 GAGGGTGGCAGGGCCAGGCTGGG + Intronic
1182911693 22:33989771-33989793 GCAGGTTGCAGGGCCAGGCGCGG - Intergenic
1183361271 22:37384594-37384616 GGGGGAGGCAGGGTCAGGTGGGG - Intronic
1183667591 22:39254449-39254471 GGGGGCAGCAGGGCGATGTGTGG + Intergenic
1183695807 22:39421516-39421538 GGTGGTGGCAGGGCAGGGTGTGG - Intronic
1183931682 22:41239140-41239162 GGCTGTGGCAGGGTGAGGTGTGG - Intronic
1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG + Exonic
1184089183 22:42283516-42283538 GAGGGTGGCCGGGAGAGGAGGGG - Intronic
1184102419 22:42347767-42347789 GCGGGTGGCAGGCCCAGCTGGGG + Intergenic
1184277085 22:43415013-43415035 GGGGGTGGCAGGGAGAAGAGGGG + Intronic
1184568159 22:45305823-45305845 CCGGGTGTCAGGGCGTGATGAGG - Intergenic
1184670275 22:46008532-46008554 GGGGGTGGCAGGGGCAGCTGAGG + Intergenic
1184688493 22:46107080-46107102 GCAGGGACCAGGGCGAGGTGTGG - Intronic
1184693542 22:46128057-46128079 GCGGGTGGCAGGGCCAGGGCAGG - Intergenic
1184795127 22:46727832-46727854 GGGGGTGGCAGGGCCGGGGGGGG - Intronic
1184930022 22:47674051-47674073 GGGGGTTGCAGGGCAAGGGGAGG + Intergenic
1185265953 22:49904101-49904123 GCGGGGGACAGGGCGATGTGGGG - Intronic
1185272385 22:49935323-49935345 GCGGGCGGCGGGGCGCGGGGTGG + Intergenic
1185335171 22:50268084-50268106 GAGGGTGGGAGGCCGAGCTGGGG - Intronic
1203251919 22_KI270733v1_random:122879-122901 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
1203259970 22_KI270733v1_random:167962-167984 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
949518866 3:4831547-4831569 GCGGTTGGGAGGGGAAGGTGGGG - Intronic
949577783 3:5355590-5355612 GCGGGGGGCGGGGGGAGGTGGGG + Intergenic
949769871 3:7568102-7568124 GCTGGTGGCAGGGCTAGCTAAGG + Intronic
950362891 3:12462372-12462394 GGTGGTGGCAGGGAGAGGAGGGG - Intergenic
950649435 3:14397935-14397957 ACAGGTGGCAGGGGTAGGTGGGG + Intergenic
950797372 3:15521019-15521041 GCAGGTGGCAGGGGCCGGTGGGG - Intronic
951578597 3:24138385-24138407 GATGGTGGCAGTGCGGGGTGTGG + Intronic
952826488 3:37529385-37529407 GGAGGTGGCAGGGGGAGGTCAGG + Intronic
953282657 3:41574286-41574308 GCTGGTGGCTGGGCAAGCTGTGG - Intronic
954003898 3:47577931-47577953 GCGGGCGGGAGGGCAAGGGGCGG + Intronic
954478460 3:50772304-50772326 GTGGGTGGCTGGGTGAGGGGAGG + Intronic
954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG + Exonic
954699927 3:52445791-52445813 GAGGGAGGCAGGGCAAGGGGAGG - Intergenic
955219434 3:57011558-57011580 GTGGGTGGCGGGGGAAGGTGGGG - Intronic
956143159 3:66165921-66165943 GGGGGTGGTGGGGAGAGGTGGGG - Intronic
956500356 3:69876410-69876432 GCGGGTGGCGGGGGGAAGCGCGG - Intronic
956745784 3:72310079-72310101 GCGGGTGGGAGGGAGGGATGGGG + Intergenic
957180892 3:76875942-76875964 GAAGGAGGCAGGGCTAGGTGTGG - Intronic
958560774 3:95744849-95744871 GCAGGCGGCTGGGGGAGGTGGGG - Intergenic
961135582 3:124507203-124507225 GGGGGTGGCAGGATGAAGTGGGG - Intronic
961164125 3:124751863-124751885 GGGGGGGGAAGGGTGAGGTGGGG - Intergenic
961536712 3:127575314-127575336 GCTGGGGGCATGGGGAGGTGTGG - Intronic
961636553 3:128336537-128336559 GCGGGTGGCAGGGCTGGCTGAGG - Intronic
962202796 3:133414769-133414791 GGGGGTGGCAGGGTGAGTAGAGG - Intronic
962245279 3:133785634-133785656 GCGGCTGGCCGGGCGGGGGGGGG - Intronic
962277908 3:134029811-134029833 GCGGCTGGCCGGGCGCGGAGTGG + Exonic
962751080 3:138435136-138435158 CCGGGTGGGAGTGGGAGGTGGGG + Intronic
963081104 3:141394389-141394411 GAGGGTGGTAGGGGGTGGTGAGG - Intronic
965544883 3:169905004-169905026 GCGGGTACCAGGGCCTGGTGGGG + Intergenic
967221835 3:187253838-187253860 GGGGGTGGCGGGGCAAGGGGAGG + Intronic
968530302 4:1087505-1087527 GGGGGTGACAGGATGAGGTGGGG + Intronic
968940552 4:3635280-3635302 GAGGGAGGCAGGGCGAAGGGCGG + Intergenic
969228532 4:5814481-5814503 GCGGATGGCAGGGGCAGGAGAGG - Intronic
969315959 4:6381447-6381469 CTGGGTGGCAGGGGTAGGTGTGG - Intronic
969464734 4:7349509-7349531 GCAGGGGGCTGGGTGAGGTGGGG + Intronic
969559565 4:7938931-7938953 GCGGGTGGAAGCGAGAGGCGCGG - Intronic
969663146 4:8542121-8542143 GAGGGTGGCCGGGAGAGGTGCGG + Intergenic
970456208 4:16226521-16226543 GCGAGGGGCGGGGCGAGGCGGGG - Exonic
970681276 4:18511327-18511349 GTGGGTGGCAGGGTGGGGTGAGG - Intergenic
972629622 4:40832313-40832335 GCCTGGGGCATGGCGAGGTGAGG - Intronic
973292332 4:48483271-48483293 CCGGGCGGCAGGGCGGGGCGGGG + Intergenic
976387856 4:84481684-84481706 GCAGGTGGAAGGGCGCGGCGCGG - Intergenic
977536551 4:98261360-98261382 GCGGGGGGCGGGGCGGGGCGGGG - Intergenic
978457384 4:108908912-108908934 CTGGTTGGCAGGTCGAGGTGGGG + Intronic
980145711 4:128981522-128981544 ACGGTTGGCAGGTCCAGGTGGGG - Intronic
980625884 4:135374315-135374337 GGGGGTGGGGGGGTGAGGTGAGG - Intergenic
982062782 4:151621541-151621563 GTGTGTGGCAGGGGGTGGTGGGG + Intronic
983347545 4:166546269-166546291 GCTTGTGGCTGGGCCAGGTGTGG + Intergenic
983589097 4:169388224-169388246 GCGGGGGGGAGGGCAAGGGGAGG - Intergenic
984206549 4:176793068-176793090 GAGGGGGGCCGGGGGAGGTGGGG - Intergenic
984734630 4:183098496-183098518 GCGGGTGACGGGGCGCGGTGCGG + Intergenic
985046872 4:185949557-185949579 GCGGGGGGCAGAGTGAGGAGTGG + Intronic
985551401 5:535233-535255 GCGGGGGCAAGGGTGAGGTGAGG - Intergenic
985577344 5:679444-679466 GGGGGTGGAAGGGCCAGGTCAGG + Intronic
985615541 5:918334-918356 GGGGGTGGCAGGTTGAGGAGTGG + Intronic
985676712 5:1235167-1235189 GTGGGTGGCAGGAGGAAGTGAGG + Intronic
985725905 5:1515621-1515643 GTGGGCGGCAGTGGGAGGTGGGG - Intronic
985898399 5:2764717-2764739 GTGGCTGGCAGGGAGAGGGGCGG - Intergenic
987102645 5:14605400-14605422 GCGGGTGGGGGGGCGTGGTGCGG + Intronic
990836183 5:60022968-60022990 GCTGGTGACAGGTCGAGCTGAGG - Intronic
993626244 5:90227930-90227952 GAGTGTGGCAGGGAGGGGTGTGG - Intergenic
994662506 5:102670630-102670652 GGGGGTGGCAGGGAGAGGAGGGG + Intergenic
994802173 5:104392625-104392647 GGGGGTGGCAGTGCGGGTTGGGG + Intergenic
995846389 5:116498585-116498607 GGGGGTGGAAGGGCGTGGTAAGG + Intronic
996209243 5:120784966-120784988 GCGGGTGGTCAGGCTAGGTGTGG - Intergenic
996354646 5:122582066-122582088 GGGGGTGGCTGGGGGAGGTTTGG + Intergenic
997067987 5:130584466-130584488 GGGGGTGGCAGGGAGACGGGAGG + Intergenic
997284379 5:132667898-132667920 GATGGTGGCAGGGAGAGCTGTGG - Intergenic
997413567 5:133708168-133708190 GAGGGAGGGAGGGAGAGGTGGGG + Intergenic
997926095 5:138032683-138032705 GCGGGTGGCAGGCGGCGCTGGGG + Intronic
998003138 5:138640134-138640156 GTGGGTGGCGGGGTGGGGTGGGG + Intronic
998026410 5:138820025-138820047 GTGGGGGGCAGGGCGGGGGGTGG - Intronic
998378572 5:141708027-141708049 GGTGGGGGCAGGGTGAGGTGGGG + Intergenic
999129413 5:149271691-149271713 GCGAGCGGCAGGGCGCGGCGGGG + Intergenic
999218797 5:149958241-149958263 GCGGGTGGAGGGGTGGGGTGGGG - Intergenic
1001403060 5:171457648-171457670 GCTGGTGGCAGGGCGGGGGCAGG + Intergenic
1001565059 5:172694742-172694764 GCAGGTGGCAGGGGCTGGTGAGG - Intergenic
1002201553 5:177531514-177531536 GCGGGTGGCTGGGGGTGGGGGGG + Intronic
1002250735 5:177927726-177927748 GGGGGTAGCAGGGGGAGGTGGGG - Intergenic
1002575868 5:180173339-180173361 CCGGGTGGCAGGCTTAGGTGGGG - Intronic
1002691465 5:181053325-181053347 GCGGGCGGCGGGGCGGGGAGGGG + Intronic
1002699818 5:181114864-181114886 GCGAGTGGCGGAGCGAGGGGCGG + Intergenic
1002897777 6:1389483-1389505 GGAGGGGGCAGGGCGGGGTGGGG + Intergenic
1003908503 6:10723124-10723146 CCCGGTGGCGGGGCGAGGAGAGG - Exonic
1004233681 6:13854810-13854832 GTGGGTGGGAGGGTGAGGCGTGG + Intergenic
1005049037 6:21666681-21666703 GCGGGGAGCGGGGCGAGTTGAGG - Intergenic
1005981472 6:30840050-30840072 GAGGGAGGCAGGGTTAGGTGAGG + Intergenic
1006030544 6:31173837-31173859 GCGGCTGGCATGGCTGGGTGGGG + Intronic
1006583734 6:35091911-35091933 GCTGGTGGCAGGGAGAGGAAGGG + Intergenic
1007403791 6:41620817-41620839 GGGGGTGGCAGGGGGAGGACCGG + Intergenic
1007415228 6:41687718-41687740 GAGGGAGGCAGGGAGAGGGGCGG + Intronic
1007556616 6:42771484-42771506 GGGGGTGGCGGGGGGTGGTGGGG + Intronic
1007633555 6:43285407-43285429 GCGGGTGGGGGGCCGGGGTGAGG - Exonic
1007644510 6:43369674-43369696 GCGCGAGGCTGGGCGAGGGGAGG + Intergenic
1010842458 6:80663127-80663149 GTGGGTGGCAGGGCCAGGGAAGG + Intergenic
1011112398 6:83853266-83853288 GCGGCTAGCAGGGAGAGGGGCGG + Exonic
1011231706 6:85169233-85169255 ACGGGTGGCAAGGAGAGGGGTGG - Intergenic
1012895316 6:104940713-104940735 GCGAGTGGCGGGGCGCGGGGAGG - Intergenic
1013306181 6:108848718-108848740 GAGGGTGGCCGGGCGGGGTGAGG + Intronic
1013369309 6:109455775-109455797 GCGGGTGGGAGGGCGGGGGCGGG + Exonic
1014148630 6:118027611-118027633 AAGCTTGGCAGGGCGAGGTGAGG - Intronic
1018036500 6:159887005-159887027 CCGGGTGCCAGGGCAGGGTGGGG - Intergenic
1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG + Intronic
1019407206 7:889925-889947 GCGGGTGTCAGGACGGGGTCTGG + Intronic
1019407217 7:889965-889987 GCGGGTGTCAGGACGGGGTCTGG + Intronic
1019407302 7:890282-890304 GCGGGTGTCAGGACGGGGTCTGG + Intronic
1019407313 7:890322-890344 GCGGGTGTCAGGACGGGGTCTGG + Intronic
1019407324 7:890362-890384 GCGGGTGTCAGGACGGGGTCTGG + Intronic
1019437504 7:1029635-1029657 GCCGGTTCCAGGGCGAGGAGAGG + Intronic
1019738033 7:2660058-2660080 GCGGGTGGCCGTGCGGGATGGGG - Intronic
1020005892 7:4783656-4783678 TGGGGTGGCATGGGGAGGTGAGG - Intronic
1020006586 7:4786558-4786580 GCGGTGTGCAGGGTGAGGTGGGG + Intronic
1020417979 7:7968586-7968608 AGGGGTGGCAGCGTGAGGTGGGG - Intronic
1020560643 7:9726518-9726540 GCGGCTGGCAGGCGGAGGAGGGG + Intergenic
1022068537 7:26886653-26886675 GGGGGTGGCGGGGCGGGATGGGG - Intronic
1022975175 7:35549959-35549981 GAGGGACGCAGGGGGAGGTGGGG - Intergenic
1023890889 7:44391257-44391279 TGGTGTGGCAGGGCCAGGTGAGG + Intronic
1024186019 7:46948820-46948842 GCGGGTGGAGGGGTGAGGTTGGG - Intergenic
1024576759 7:50770669-50770691 GCAGGTGGCAGGGGGATGGGGGG + Intronic
1025110376 7:56211493-56211515 AGGGGAGGCAGGGAGAGGTGAGG + Intergenic
1025212748 7:57030019-57030041 GCGGGGGGCAGGGGGCGGTGGGG + Intergenic
1025636266 7:63322263-63322285 GCGGGTGGGGGGGCTAGGGGAGG + Intergenic
1025646430 7:63425913-63425935 GCGGGTGGGGGGGCTAGGGGAGG - Intergenic
1025659205 7:63546805-63546827 GCGGGGGGCAGGGGGCGGTGGGG - Intergenic
1026592705 7:71710813-71710835 GCGGGTGTCAGGGAGGAGTGTGG - Exonic
1026909768 7:74084862-74084884 GTTGGTGGCAGGGGGAGGTGTGG - Intronic
1026941904 7:74291883-74291905 CAGGGTGGCAGGGCCAGGAGGGG - Intronic
1027548634 7:79562585-79562607 GCGGGTGGATGGGTGAGGGGAGG - Intergenic
1028954522 7:96673996-96674018 GCGGGAGTCAGGGAGAGGGGAGG - Intronic
1029252277 7:99245300-99245322 GCTGGTGGCAGGGACAGGGGTGG + Intergenic
1029273722 7:99392343-99392365 GGGGGTGCCAGGGCCAGGTCAGG + Intronic
1029405311 7:100371462-100371484 GTGGGTGCCAAGGAGAGGTGAGG + Intronic
1029420248 7:100468279-100468301 GCTGGTGGCTGGGCCAGGGGAGG + Intronic
1029744963 7:102511761-102511783 TGGGGTGTCAGGGCGAGGTGGGG + Intronic
1029762955 7:102610922-102610944 TGGGGTGTCAGGGCGAGGTGGGG + Intronic
1030227566 7:107169466-107169488 GTGGGTGGCCGGGCCGGGTGTGG + Intronic
1030820747 7:114087719-114087741 TCGGGTGTCAGGGCGCGTTGCGG - Intronic
1031147565 7:118013918-118013940 TCTGGTGGCAGGGTGGGGTGTGG - Intergenic
1031954666 7:127930132-127930154 AAGGGTGGCTGGGCGGGGTGGGG - Intronic
1032945010 7:136840323-136840345 GCGGGTGACAGGGTGAGGGGAGG + Intergenic
1033165612 7:139036143-139036165 GCGGGAGGCCGGGCGAGGGGCGG + Intergenic
1033798488 7:144874831-144874853 GAGGGAGGGAGGGAGAGGTGGGG - Intergenic
1034084151 7:148308717-148308739 GGGGGTGGGAGGGCTAGGGGAGG - Intronic
1035600569 8:894722-894744 GTGGCTGGCAGGGCAGGGTGGGG + Intergenic
1035600665 8:894998-895020 GTGGCTGGCAGGGCAGGGTGGGG + Intergenic
1035602182 8:903035-903057 GCGGGTGGACGGGGGCGGTGGGG + Intergenic
1035717068 8:1763390-1763412 GCGGGGGGCGGGGCGCGGCGCGG - Intronic
1035717075 8:1763407-1763429 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717084 8:1763424-1763446 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717093 8:1763441-1763463 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717102 8:1763458-1763480 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717111 8:1763475-1763497 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717120 8:1763492-1763514 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717129 8:1763509-1763531 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717138 8:1763526-1763548 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717147 8:1763543-1763565 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717156 8:1763560-1763582 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717165 8:1763577-1763599 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717174 8:1763594-1763616 GCGGGGGGCGGGGCGCGGCGGGG - Intronic
1035717185 8:1763613-1763635 GCGGGGGGCGGGGCGCGGCGCGG - Intronic
1036780450 8:11643342-11643364 GCGGCTGGGAGGGCGAGGGTTGG - Intergenic
1037014144 8:13881659-13881681 TCGGGAGGCAGAGAGAGGTGGGG + Intergenic
1037817728 8:22120710-22120732 ACTGGAGGCAGGGCCAGGTGAGG - Exonic
1038828559 8:31033199-31033221 GCGGGGGGCAGTGCGAGCGGCGG - Exonic
1038871295 8:31496699-31496721 GCGGGTGGTGGGGGCAGGTGCGG - Intergenic
1039425211 8:37479676-37479698 GCGGGTGGCAGGGGGAGCACAGG + Intergenic
1039842277 8:41302782-41302804 GTGGGGGCCAGGGGGAGGTGGGG - Intronic
1040423389 8:47260875-47260897 GCCAATGGCAGGGCGCGGTGCGG + Exonic
1042962924 8:74321664-74321686 GCTGGGGGCAGGGCCCGGTGGGG - Intronic
1043141014 8:76590849-76590871 GCTGGGGGCAGAGTGAGGTGAGG - Intergenic
1043398954 8:79864925-79864947 CCGGGGGGCAGGGCGGGGGGGGG + Intergenic
1045701295 8:104869884-104869906 GCAGGAGCCAGGGAGAGGTGTGG + Intronic
1046595897 8:116260764-116260786 GCGGTTGGCAGGAGGAGTTGTGG + Intergenic
1046721705 8:117627447-117627469 GCAGGTGGCAGGACTAGATGTGG + Intergenic
1047499605 8:125431088-125431110 GCGGGCTGCAGGGCGAGCCGGGG - Exonic
1048018008 8:130514579-130514601 GCTGGTGGCAGAGTGAGGTCTGG + Intergenic
1048167622 8:132077349-132077371 GAAGGTGGAGGGGCGAGGTGAGG + Intronic
1048321589 8:133404394-133404416 GATGGGGGCAGGGAGAGGTGGGG + Intergenic
1048480115 8:134782022-134782044 GGGGGTGGCAGGGTGGGGTTAGG + Intergenic
1049094496 8:140540427-140540449 CCGTGTGGCATGGCGAGGGGTGG + Intronic
1049132756 8:140862830-140862852 GGGTGTGGCAGGGTGGGGTGTGG - Intronic
1049217740 8:141415623-141415645 GCGGGGGGCAGGGGGCGGGGCGG + Intronic
1049372669 8:142275145-142275167 GGGAGTGGCAGGCGGAGGTGAGG + Intronic
1049376418 8:142291535-142291557 GTGGGTGGCAGTGCTGGGTGGGG - Intronic
1049396350 8:142402953-142402975 GCGGGAGGCCGGGCGGGGGGCGG - Intronic
1049440485 8:142607289-142607311 GAGGGTGGCAGGGAGGGGAGTGG + Intergenic
1049533850 8:143169056-143169078 GAGGGGTGCAGGGTGAGGTGGGG - Intergenic
1049763084 8:144339564-144339586 GGGAGGGGCAGGGAGAGGTGCGG - Intergenic
1049807592 8:144547975-144547997 GCTGCTGGCAGGGCGAGGGGGGG + Exonic
1051859151 9:21604525-21604547 GCTGATGGCAGGGCATGGTGAGG + Intergenic
1052049721 9:23831272-23831294 GTGGGGGGCAGGGCGGCGTGCGG - Intergenic
1052494936 9:29213489-29213511 GCGGGCGGCGGCGCCAGGTGAGG + Intergenic
1053131898 9:35620047-35620069 GCTGGTGGCAGGGGTGGGTGGGG + Intronic
1053168966 9:35864893-35864915 GGCAGTGGCAGGGCGAGGTGCGG - Intergenic
1054112568 9:61123644-61123666 GCGGGAGGCAGGGGGCGGGGGGG + Intergenic
1054595141 9:67058487-67058509 GCGGGAGGCAGGGGGCGGGGGGG - Intergenic
1055403386 9:75948301-75948323 GGGGGTGGGGGGGCGAGGGGAGG - Intronic
1055490241 9:76797667-76797689 GCGGGGGGCAGGGTGGGGGGCGG - Intronic
1055501435 9:76906158-76906180 GCCGGCGGCCGGGCGAGGGGTGG - Intergenic
1056715417 9:89024518-89024540 GCAGGTGGCAGGCCAAGTTGTGG - Intronic
1057039427 9:91836696-91836718 GAGGGTGGCAGGAGGAGCTGCGG + Intronic
1057083689 9:92190091-92190113 GCTGGGGTCAGGGCGAGGTCAGG - Intergenic
1057263976 9:93601932-93601954 GGGGGTGGTAGGGTGGGGTGGGG + Intronic
1057337462 9:94166706-94166728 GCGGGGGGAAGGGCGGGGTAAGG - Intergenic
1057432207 9:95004857-95004879 GCGGGCGGGAGGGCGACCTGCGG + Intronic
1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG + Intronic
1057616520 9:96595789-96595811 GCGCCTGGCTGGGAGAGGTGAGG + Intronic
1058495741 9:105557515-105557537 GGGGCTAGCAGGGCGGGGTGTGG - Intergenic
1058656658 9:107228467-107228489 CCTGGTGGCAGGGCAAGATGGGG + Intergenic
1058903356 9:109460711-109460733 GAGAGTGCCAGGGCAAGGTGAGG - Intronic
1059455525 9:114398080-114398102 GCTGGTGGCAGGGAGGGGAGGGG - Intergenic
1060010842 9:120041664-120041686 GAGTGTGGCAGGGGGAGGAGGGG - Intergenic
1060545194 9:124455130-124455152 GAGGCTGGCAGGGCTGGGTGGGG + Intronic
1060550121 9:124481074-124481096 GTGGGTGGCGGGGCCGGGTGGGG - Intergenic
1060793399 9:126500152-126500174 GGGGGTGGCAGGGAGTGCTGAGG - Intronic
1060918519 9:127405004-127405026 GTGGGAGGCTGGGCGAGGAGTGG + Intronic
1061060428 9:128247487-128247509 GTGAGTGGCAGGGCAAGGAGAGG + Intronic
1061248414 9:129413365-129413387 GCGGGGGGCAGGGCGAGAGCAGG - Intergenic
1061248601 9:129413987-129414009 GCGGGCGGCAGGGGCAGGTCTGG - Intergenic
1061415421 9:130444759-130444781 GTGGGAGGCGGGGGGAGGTGGGG + Intergenic
1061681019 9:132242447-132242469 GTGGGAGGCAGGACGGGGTGTGG - Exonic
1061820539 9:133225253-133225275 GTGGGTGCCAGGACGAGATGCGG + Intergenic
1061840591 9:133356597-133356619 GCGAGTTGCCGGGCGACGTGCGG + Exonic
1061972104 9:134050413-134050435 GGGTGTGGCAGGAGGAGGTGGGG + Exonic
1062045154 9:134421589-134421611 GCGTGTGGCAGGGCCTGGTCTGG + Intronic
1062238728 9:135524805-135524827 GTGGGTGCCAGGACGAGATGTGG - Intronic
1062298322 9:135847699-135847721 GGGGGTGGGAGGGCTAGGAGAGG + Intronic
1062534126 9:137014143-137014165 GGGGGTGGCAGGGTGAGGCTGGG - Intronic
1062587737 9:137257038-137257060 CCAGGCGCCAGGGCGAGGTGAGG + Exonic
1203468321 Un_GL000220v1:106030-106052 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
1203476142 Un_GL000220v1:150002-150024 GCGGGCGGGACGGCGAGGTCGGG - Intergenic
1203562683 Un_KI270744v1:71730-71752 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1186730408 X:12403540-12403562 GCGGCGGGCAGGGAGAGGAGTGG - Intronic
1187039901 X:15582719-15582741 GAAGGTGGCAGGGGCAGGTGAGG + Intronic
1187102124 X:16204245-16204267 GGGACTGGCAGGGGGAGGTGGGG + Intergenic
1189252327 X:39611011-39611033 GCAGGTGGCAGGGGGTGGTGGGG + Intergenic
1190056854 X:47186172-47186194 GTGAGTGGCTGGGCCAGGTGAGG + Intronic
1190137060 X:47807040-47807062 GCTGGGGGCAGGAGGAGGTGGGG + Intergenic
1190680908 X:52826944-52826966 GCGGCTGGCCGGGCGGGGGGTGG + Intergenic
1190730836 X:53224643-53224665 GCGGAGGGCAGCTCGAGGTGGGG - Intronic
1190745913 X:53321486-53321508 GCGGGTGGCAGCCGCAGGTGGGG - Intergenic
1192039192 X:67599106-67599128 GCGGGTGGCAGTGGCATGTGTGG + Intronic
1192166046 X:68828405-68828427 GCGGGGAGCAGGGTGGGGTGTGG - Intergenic
1192804215 X:74495383-74495405 GCCTGTGGGAGGGAGAGGTGAGG - Intronic
1193539811 X:82757648-82757670 GGGGGTGGGGGGGCGGGGTGGGG - Intergenic
1195923772 X:110005379-110005401 GAGGGTGGCAGTGGGTGGTGGGG + Intronic
1196419538 X:115507957-115507979 GCGGGTGGCAGGGAGGGGGTGGG - Intergenic
1196754420 X:119145439-119145461 GAGGGTGGCAGGGGCATGTGGGG - Intronic
1197980727 X:132216546-132216568 GGGGGTGGGAGGGGAAGGTGTGG + Intronic
1198388261 X:136148058-136148080 GTGGGGGGTGGGGCGAGGTGGGG + Intronic
1198727343 X:139691742-139691764 GCGGGCGGGCGGGCGAGGTGGGG + Intronic
1199487571 X:148364931-148364953 ACAGGTGGCAGGGCCGGGTGCGG - Intergenic
1199491336 X:148403662-148403684 TCGGGTGGCGGGGCGGGGGGGGG - Intergenic
1200109966 X:153736071-153736093 GTGGGTGGCGGGGCGGGGAGGGG - Intronic
1200256477 X:154585542-154585564 GGGGAGGGCAGGGCCAGGTGGGG + Intronic
1200261292 X:154618861-154618883 GGGGAGGGCAGGGCCAGGTGGGG - Intronic