ID: 1018063619

View in Genome Browser
Species Human (GRCh38)
Location 6:160109796-160109818
Sequence CTAAAGCCGCTGGGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018063619_1018063631 17 Left 1018063619 6:160109796-160109818 CCTGCCCCACCCAGCGGCTTTAG 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1018063631 6:160109836-160109858 ACAATTAGGGAGAGGGCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1018063619_1018063628 4 Left 1018063619 6:160109796-160109818 CCTGCCCCACCCAGCGGCTTTAG 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1018063628 6:160109823-160109845 CAGCTCTTCAGGAACAATTAGGG 0: 1
1: 1
2: 0
3: 13
4: 134
1018063619_1018063627 3 Left 1018063619 6:160109796-160109818 CCTGCCCCACCCAGCGGCTTTAG 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1018063627 6:160109822-160109844 TCAGCTCTTCAGGAACAATTAGG 0: 1
1: 0
2: 1
3: 11
4: 216
1018063619_1018063626 -7 Left 1018063619 6:160109796-160109818 CCTGCCCCACCCAGCGGCTTTAG 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1018063626 6:160109812-160109834 GCTTTAGGACTCAGCTCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 155
1018063619_1018063632 18 Left 1018063619 6:160109796-160109818 CCTGCCCCACCCAGCGGCTTTAG 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1018063632 6:160109837-160109859 CAATTAGGGAGAGGGCCCTTGGG 0: 1
1: 0
2: 1
3: 4
4: 89
1018063619_1018063630 10 Left 1018063619 6:160109796-160109818 CCTGCCCCACCCAGCGGCTTTAG 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1018063630 6:160109829-160109851 TTCAGGAACAATTAGGGAGAGGG 0: 1
1: 0
2: 3
3: 15
4: 272
1018063619_1018063629 9 Left 1018063619 6:160109796-160109818 CCTGCCCCACCCAGCGGCTTTAG 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1018063629 6:160109828-160109850 CTTCAGGAACAATTAGGGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018063619 Original CRISPR CTAAAGCCGCTGGGTGGGGC AGG (reversed) Intronic
900210023 1:1450827-1450849 CTACTGCCGGTGGGTAGGGCCGG + Intronic
900220081 1:1503730-1503752 CTACTGCCGGTGGGTAGGGCTGG + Intergenic
900222384 1:1516157-1516179 CTACTGCCGGTGGGTAGGGCCGG + Intronic
900839432 1:5036000-5036022 CTAAGGCCTCTGGCTGAGGCTGG + Intergenic
902817198 1:18923068-18923090 CCAAAGCCGCTGAGCAGGGCAGG + Intronic
902983495 1:20141698-20141720 CTCAAGGCGCTGTGTGGGCCAGG + Intronic
904322588 1:29707255-29707277 CTAGCGCGGCTGGGCGGGGCCGG + Intergenic
906206010 1:43986824-43986846 GCATAGCCGCTGGGTGGAGCAGG + Intronic
907256114 1:53180427-53180449 CTAAAGCAGCTGGGCAGGCCTGG - Intergenic
908114214 1:60925095-60925117 CTCAGGCAGCTGGGTGAGGCGGG - Intronic
908308367 1:62849241-62849263 TTAAAGCCACTAGATGGGGCTGG - Intronic
912539959 1:110407415-110407437 CCAAGGCCGCAGGGCGGGGCGGG - Intronic
913082631 1:115403055-115403077 CAAAGGTCGCTTGGTGGGGCAGG - Intergenic
913531935 1:119739756-119739778 ATCAGGCCCCTGGGTGGGGCAGG + Intronic
915089963 1:153417373-153417395 CTTAAGCTGCTGGATGGGGTGGG - Intronic
915092912 1:153439032-153439054 CTTAAGCTGCTGGATGGGGTGGG + Intronic
915222412 1:154385528-154385550 CTAAAGCCACTGAGTTGGGGTGG - Intergenic
916558199 1:165910908-165910930 ATTAGGCCGCTGGGTCGGGCTGG + Intronic
919343376 1:196343276-196343298 CTAAAGCCACTGAGTTAGGCGGG - Intronic
919486814 1:198156935-198156957 CTCACGACGCGGGGTGGGGCCGG + Intergenic
919762312 1:201105925-201105947 CCAAACTGGCTGGGTGGGGCAGG - Intronic
919916729 1:202143972-202143994 TTAAGCCCTCTGGGTGGGGCTGG + Intronic
920362963 1:205432008-205432030 CTAAAGCTTCTGTGTTGGGCGGG - Intronic
921160985 1:212472073-212472095 CTAAGGCCGCTGTGTGGGGAGGG - Intergenic
922537004 1:226388892-226388914 CTAAGGGCACTGAGTGGGGCAGG - Intronic
922662232 1:227440132-227440154 CTAAAGCTGCTGGGGTGGTCTGG - Intergenic
923221077 1:231893705-231893727 ATAAAGCCTCTGGGTGGGCGTGG + Intronic
924195311 1:241601219-241601241 ATAAAGCCCCTGGGTGTGGCCGG - Intronic
1065482871 10:26212653-26212675 CTGAAGTGGCTGGGTGGTGCTGG - Intergenic
1067047179 10:42991329-42991351 CTCAAGCCGGCGGCTGGGGCTGG - Intergenic
1069740082 10:70681840-70681862 CTAGAGACCCTGGGAGGGGCAGG + Intronic
1069988110 10:72297911-72297933 CTCAGGCCGCTGGGGAGGGCCGG - Intergenic
1069993693 10:72329830-72329852 CCAAGGCCACTGGGTGGGCCTGG + Intergenic
1070708366 10:78657942-78657964 CTGATGCCTCTGGGTGGGGGTGG + Intergenic
1075068251 10:119303963-119303985 CTAAAGCGCCAGGGTGGTGCTGG + Intronic
1075091524 10:119446582-119446604 CTCAAGGCACTGGGTTGGGCTGG - Intronic
1075627597 10:123973737-123973759 CTGAAGGAGCTGGATGGGGCTGG - Intergenic
1076554497 10:131312427-131312449 CGACACCCCCTGGGTGGGGCAGG + Intergenic
1076661744 10:132059954-132059976 CCACAGCTGCTGGGTTGGGCAGG + Intergenic
1077510310 11:2956640-2956662 CTAAAACCCCTGGGTGATGCTGG - Intronic
1078801028 11:14644115-14644137 CTGCAGCCGCCGGATGGGGCCGG + Exonic
1079340336 11:19606510-19606532 CTGAAGCAGTTGGGAGGGGCAGG - Intronic
1079351505 11:19695606-19695628 CTAAAGACACTGGATGGGCCGGG + Intronic
1079864312 11:25716235-25716257 GTGAAGCCCCTGGGTGTGGCTGG - Intergenic
1080233870 11:30046739-30046761 GTACAGCATCTGGGTGGGGCTGG - Intergenic
1080838073 11:35958970-35958992 CCAATGCTGCTGGGAGGGGCAGG - Intronic
1081644030 11:44777565-44777587 GCAAAGCCCCTGGGTAGGGCTGG + Intronic
1084727546 11:70951764-70951786 CTAGAGCCTTTGGGTGGGGGTGG - Intronic
1087150924 11:94858968-94858990 CTCAGGCCTCTGAGTGGGGCAGG + Intronic
1091311328 11:134577126-134577148 CTGAACCTGCTGGGTGGGCCTGG + Intergenic
1091705128 12:2688565-2688587 CTCAAGCCGCAGGGTGGGGACGG - Exonic
1092587265 12:9912228-9912250 CTGAAGCCCTTGGGTGGGGAAGG + Intronic
1094195643 12:27746730-27746752 CTTCAGCCACTGGGTGGGGAAGG - Intronic
1096673623 12:53214785-53214807 CTGCAGGCCCTGGGTGGGGCTGG - Intronic
1101228262 12:102712008-102712030 CTTAAGCAGCTGGTTTGGGCTGG + Intergenic
1102897628 12:116611334-116611356 ACATAGCCTCTGGGTGGGGCAGG - Intergenic
1106402254 13:29441940-29441962 CTAAAGCCGGTGAGTGGAGAAGG - Intronic
1106421911 13:29592293-29592315 TGAAAGCCACTGGGTGTGGCAGG + Intronic
1106846780 13:33745249-33745271 TTAGAGCAGCTGGGTGGAGCAGG + Intergenic
1110619939 13:77584280-77584302 CTCAAGCCCTGGGGTGGGGCGGG - Intronic
1113902292 13:113803954-113803976 CCAGAGCCGCTGCGAGGGGCTGG - Intronic
1115165886 14:30448418-30448440 CTAAATCCTGGGGGTGGGGCGGG - Intergenic
1116860310 14:49990184-49990206 CAACAGCAGCTGAGTGGGGCTGG - Intronic
1116919362 14:50556512-50556534 CTAAAGCCACTGGATTAGGCTGG - Intronic
1119539064 14:75427357-75427379 CTAAGGGCGCTGGCGGGGGCCGG + Intergenic
1122721875 14:103726848-103726870 CTGAGGCCGCTGAGTGGGGGTGG + Intronic
1122837484 14:104437279-104437301 CTCCTGCAGCTGGGTGGGGCCGG - Intergenic
1126394920 15:48204503-48204525 CAAATTCAGCTGGGTGGGGCTGG - Intronic
1130226569 15:82063243-82063265 GTAAGGCTGGTGGGTGGGGCTGG + Intergenic
1130261190 15:82355457-82355479 CTGCGGCCGCTCGGTGGGGCGGG + Intergenic
1130280045 15:82513561-82513583 CTGCGGCCGCTCGGTGGGGCGGG - Intergenic
1130471420 15:84229747-84229769 CTGCGGCCGCTCGGTGGGGCGGG - Intergenic
1130478914 15:84344318-84344340 CTGCGGCCGCTCGGTGGGGCGGG - Intergenic
1130492856 15:84443813-84443835 CTGCGGCCGCTCGGTGGGGCGGG + Intergenic
1130593714 15:85234374-85234396 CTGCGGCCGCTCGGTGGGGCGGG - Intergenic
1132819903 16:1859825-1859847 CCAAACCCGCAGGATGGGGCGGG - Intronic
1135422554 16:22314857-22314879 CTCAAGCCTCTGGGCTGGGCAGG + Intronic
1137985981 16:53108576-53108598 TTAAAACCTCTGTGTGGGGCCGG + Intronic
1144270394 17:13609902-13609924 CTAAAGCCAGAGGGTGAGGCTGG - Intergenic
1147238443 17:39074722-39074744 CTAAACCCTCTGGGTGGGGCAGG + Intronic
1148212774 17:45818236-45818258 TTCAGGCTGCTGGGTGGGGCCGG + Intronic
1152491115 17:80635358-80635380 CTAAAGCCACAAGGTGGGTCTGG - Intronic
1152638546 17:81440058-81440080 CTGAATCCCCTGGGTGGGGCTGG - Intronic
1152784353 17:82240288-82240310 CTTCAGCTGCTGGGTGGGACTGG - Intronic
1152928056 17:83096897-83096919 CTGAAGCAGCAGGCTGGGGCTGG + Intergenic
1155243287 18:23883650-23883672 ATAAAGCTGCAGGATGGGGCGGG - Intronic
1157125208 18:44950235-44950257 GCAGAGCTGCTGGGTGGGGCTGG - Exonic
1157618929 18:49004090-49004112 CCAGAGACTCTGGGTGGGGCTGG + Intergenic
1159922488 18:74238269-74238291 CTGAAAACTCTGGGTGGGGCAGG + Intergenic
1160443751 18:78912072-78912094 CTAAAGGCCCTGGGGGGAGCTGG - Intergenic
1160508194 18:79438797-79438819 CTCAGGACGCAGGGTGGGGCGGG + Intronic
1160741613 19:688893-688915 TTAAAGTCCCTGTGTGGGGCCGG - Intronic
1160915292 19:1493418-1493440 CTAAAGCAGGTGGGAGGGGCTGG + Intronic
1161065815 19:2236759-2236781 CTCACGCCGCTGGGCGGGCCAGG + Exonic
1161657793 19:5526385-5526407 CTAAAGCCTAGGGGAGGGGCTGG + Intergenic
1162063490 19:8110988-8111010 CTGCAGACTCTGGGTGGGGCAGG - Intronic
1162188104 19:8922794-8922816 CTAAAATCAGTGGGTGGGGCAGG + Intronic
1162744155 19:12789765-12789787 CCAAAGCGGCGGGGTGGGGCGGG + Intronic
1165718793 19:38064051-38064073 CTGTAGCTGCTGGGTGGGCCTGG + Intronic
1166084476 19:40465858-40465880 CTAACGCGGATGGGCGGGGCAGG + Intergenic
1166310649 19:41960489-41960511 CCAAAGCAGCTGGGTGGGGCTGG + Intergenic
1166493708 19:43282897-43282919 CTCCAGCCGGGGGGTGGGGCAGG - Intergenic
1166866277 19:45839548-45839570 TTAAAACCACTGGGTGAGGCTGG + Intronic
926297723 2:11580810-11580832 CTAAAGCCGATGGTCGCGGCAGG - Exonic
933090449 2:78110556-78110578 CTACAGCACCTGGGTGGGACTGG + Intergenic
933776825 2:85776158-85776180 CTCAAGCAGCTGGGCAGGGCTGG + Intronic
935364901 2:102278905-102278927 CTTAAGCTGCAGGGTGAGGCAGG - Intergenic
936080571 2:109429913-109429935 CTACACCCGCTGACTGGGGCTGG - Intronic
936738900 2:115480024-115480046 CTATAGCCTCTGGGTGCTGCAGG + Intronic
936938302 2:117859036-117859058 CCGACGCCGCTGGGTGGGGGAGG + Intergenic
938644450 2:133316712-133316734 CTACTGCCGCTGGGTGGGAATGG + Intronic
939057426 2:137381812-137381834 CTGAAGTCCCTGGGTGGGACTGG - Intronic
940338647 2:152556276-152556298 CTAAAGCAGCTGGGGGTGTCAGG + Intronic
946676433 2:222164623-222164645 ATAAAAGCGCAGGGTGGGGCGGG + Intergenic
948593804 2:239067114-239067136 CTGCAGCCTCTGGGTGGGGCTGG - Intronic
1169124238 20:3115657-3115679 CTGAAGCCGGTGGGATGGGCAGG - Intronic
1170377465 20:15716457-15716479 CTAAAGCAGCTGGGAGCTGCTGG + Intronic
1172424375 20:34845309-34845331 GTAGAGCAGCGGGGTGGGGCGGG - Exonic
1175683055 20:61005457-61005479 CTTCAGCCGCTGGGTGGGCCTGG + Intergenic
1175735629 20:61385194-61385216 CTAAAGCCTCTGGAAGTGGCAGG + Intronic
1175815673 20:61882049-61882071 CTCAAGCCCCTGGATGGAGCCGG + Intronic
1175985082 20:62760620-62760642 TGAAAGGTGCTGGGTGGGGCCGG + Exonic
1176264898 20:64204008-64204030 CTAAGGCAGGTGGGAGGGGCAGG - Intronic
1177651857 21:23968290-23968312 CTGAAGCGTCTGGGTGGGACTGG + Intergenic
1179289861 21:40009046-40009068 CTAAAGCAGATGTGGGGGGCAGG + Intergenic
1179468309 21:41593131-41593153 GTGAAGCCCCTGGGTGTGGCCGG - Intergenic
1179602691 21:42490843-42490865 CAAAAGTTGGTGGGTGGGGCTGG - Intronic
1180019894 21:45116240-45116262 CTTCAGCCCCAGGGTGGGGCTGG + Intronic
1181017826 22:20081192-20081214 ATACTGCCGCTGGGTTGGGCGGG + Intronic
1181387622 22:22557618-22557640 CCCTAGCCGCTGCGTGGGGCGGG + Intronic
1181667942 22:24411397-24411419 CTACAGCTGGTGGGTGGGACGGG + Intronic
1181813125 22:25417114-25417136 CTATAAACGCTGGGTGGGGTGGG - Intergenic
1181831105 22:25561321-25561343 CTATAAACGCTGGGTGGGGTGGG - Intergenic
1182696349 22:32201746-32201768 CAAGAGGGGCTGGGTGGGGCTGG - Intronic
1184773900 22:46613730-46613752 CTGAAGCCTCGGGGTGGGGTGGG - Intronic
1184814078 22:46857306-46857328 CTGCTGCCCCTGGGTGGGGCTGG + Intronic
952041819 3:29269985-29270007 GTAAAGTTGCTGGGAGGGGCTGG + Intergenic
953982231 3:47418632-47418654 GTAAGGCTGCTGGGTGGGGTGGG - Intronic
954385662 3:50242557-50242579 CTAGAAGGGCTGGGTGGGGCTGG - Intronic
954585325 3:51730199-51730221 CTAGGTCTGCTGGGTGGGGCTGG + Intergenic
963204088 3:142614909-142614931 CTTCAACAGCTGGGTGGGGCTGG + Intronic
964987790 3:162766087-162766109 CTAGAGCCACAGGGTGGTGCGGG - Intergenic
967880320 3:194297159-194297181 CTTGAGCCACTGGCTGGGGCTGG - Intergenic
968230929 3:197003952-197003974 CTACCGCGGCTGGCTGGGGCTGG - Exonic
968505711 4:970441-970463 CTAAGGGCTCTGGGTGGGGCAGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968615235 4:1574745-1574767 CTGGAGCCGGTGGGTGGGGCTGG + Intergenic
968728000 4:2257096-2257118 TTCAGGCCGCTGGCTGGGGCGGG - Intronic
968916874 4:3500474-3500496 CAAGGGCTGCTGGGTGGGGCTGG - Intronic
969534238 4:7746166-7746188 CTAAAGACTCTGGGTGTGGCTGG - Intergenic
971016936 4:22498131-22498153 CTCAGGAGGCTGGGTGGGGCAGG + Intronic
979292045 4:118989164-118989186 CTAAAGCAGCTGAGTGCAGCCGG - Intronic
980994430 4:139766597-139766619 AGAAAGCAGCTGGGTGTGGCCGG - Intronic
981353598 4:143761345-143761367 CTCAAGCCTCTGGGTTGTGCTGG + Intergenic
982526148 4:156482001-156482023 CTGGGGCCGGTGGGTGGGGCCGG + Intergenic
983947478 4:173602657-173602679 CCAAAACCACTGGGTGGGGCAGG + Intergenic
985225073 4:187751319-187751341 TGAAAGCAGCTGGGTGGGGGTGG + Intergenic
985800809 5:2004543-2004565 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
985800862 5:2004746-2004768 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
985800896 5:2004869-2004891 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
985800969 5:2005156-2005178 CTAGAGCCCTTGTGTGGGGCAGG + Intergenic
990948607 5:61275197-61275219 CTGAAGCGTCTGGGAGGGGCTGG - Intergenic
991457963 5:66824459-66824481 CGAGAGCTGCTGGATGGGGCTGG + Intronic
992970962 5:82057380-82057402 CTAAAGCCTCTGGTGGGAGCAGG - Intronic
1001628177 5:173154424-173154446 CAGAAGCCGCTGGCGGGGGCAGG - Intronic
1002099324 5:176849648-176849670 CTTCAGGGGCTGGGTGGGGCTGG - Intronic
1007371412 6:41428701-41428723 TTAAAGCCCCTGGAAGGGGCCGG + Intergenic
1015415959 6:132948917-132948939 CTAAAGCCCTTGGGAGGGGAGGG + Intergenic
1018063619 6:160109796-160109818 CTAAAGCCGCTGGGTGGGGCAGG - Intronic
1018670305 6:166171529-166171551 CTAGAGCAGCAGGGAGGGGCCGG - Intergenic
1019275462 7:173322-173344 CTACAGCCCCTGGGGTGGGCTGG - Intergenic
1019373193 7:674256-674278 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019373206 7:674351-674373 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019373251 7:674643-674665 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019483723 7:1278040-1278062 TTAAAACCGATGGGTGGGCCAGG + Intergenic
1019562245 7:1664878-1664900 CGAAAGCCGCAGGCTGGGGAAGG + Intergenic
1020279730 7:6644097-6644119 CCATGGCCCCTGGGTGGGGCGGG + Intronic
1022511101 7:30935389-30935411 ATAAGGGAGCTGGGTGGGGCAGG + Intergenic
1023853427 7:44163815-44163837 CTAGAGCAGCTGGCTGGAGCAGG + Intronic
1024061821 7:45703952-45703974 CCAGGGCCACTGGGTGGGGCTGG + Intronic
1024229647 7:47354452-47354474 CCAAAGCCCTGGGGTGGGGCAGG + Intronic
1024980936 7:55157067-55157089 CCAAGGCAGCTGGCTGGGGCCGG - Intronic
1025257606 7:57395779-57395801 CTGGAGCCCCTGGGAGGGGCGGG + Intergenic
1029652189 7:101901182-101901204 GTAATGCCCCTGGGTAGGGCGGG + Intronic
1030172669 7:106619724-106619746 CTTGAGCAGCTGGGAGGGGCAGG - Intergenic
1030218203 7:107068258-107068280 CTAAAGAGGCTGGAGGGGGCAGG + Intronic
1030657541 7:112184426-112184448 GTAATGCCCCTGGGTGAGGCCGG - Intronic
1031981673 7:128130948-128130970 CAAAAGCCACTGGGTAGGGCTGG + Intergenic
1034431980 7:151045687-151045709 TTGAAGCTGCTGGGTGGGGCAGG - Intronic
1035341589 7:158166133-158166155 CTGAAGCTGATGGATGGGGCGGG - Intronic
1035400915 7:158564991-158565013 GTAAAGCCGTTACGTGGGGCAGG - Intronic
1035410540 7:158637344-158637366 CTAAAGCAGGTGGGTGGGTTTGG - Intronic
1036528272 8:9555993-9556015 CTGAAGCCCCTGGGGCGGGCTGG - Exonic
1036785551 8:11683660-11683682 CTAAAGCCGGAGACTGGGGCGGG + Intronic
1038710472 8:29939396-29939418 CTAAAGACGATGGGTGGGATGGG + Intergenic
1047732476 8:127738105-127738127 CTAAAGCGGCTGGGTGGTCTTGG - Intronic
1048563380 8:135567090-135567112 CTATAGCAGCTGAGTGGGGTTGG + Intronic
1049407298 8:142457467-142457489 CCCAGGCAGCTGGGTGGGGCTGG + Intronic
1049789242 8:144465521-144465543 CTAGAGCGGCTGGGGGGGGAGGG + Intronic
1050844197 9:10193353-10193375 CTAAAGCCTCTGTGTGCGGTTGG + Intronic
1051502753 9:17795858-17795880 CCAAAGTCACTTGGTGGGGCTGG - Exonic
1053069561 9:35093065-35093087 CTAAAGCAGAGGAGTGGGGCTGG + Exonic
1057553193 9:96067114-96067136 CCAAAACCGCAGGGTGGGGGCGG - Intergenic
1058967287 9:110049395-110049417 CGAAAGACTCTGGCTGGGGCCGG - Intronic
1058985797 9:110207598-110207620 CAAACACAGCTGGGTGGGGCAGG + Exonic
1060810166 9:126607295-126607317 ATAAGGCAGCAGGGTGGGGCAGG - Intergenic
1061275808 9:129568926-129568948 CCAAGCCCGCTGGGCGGGGCGGG - Intergenic
1061294943 9:129671932-129671954 CTAAAGCGGGTGGGAGGGGAGGG + Intronic
1061959738 9:133981973-133981995 CTAAAGCCTTTGGCAGGGGCTGG - Intronic
1189563067 X:42210670-42210692 GTAAAGAAGCTGGGTGTGGCCGG - Intergenic
1190108124 X:47573432-47573454 GCAGAGCAGCTGGGTGGGGCAGG + Intronic
1190274476 X:48891411-48891433 CTCCGGCCGCTGGCTGGGGCGGG - Intergenic
1192038614 X:67593052-67593074 CTAAACCAGCTGGGTGGGAAAGG - Intronic
1192167124 X:68833186-68833208 CTAGAACAGCTGTGTGGGGCTGG - Intronic
1199780271 X:151052035-151052057 CAGATGCCACTGGGTGGGGCTGG - Intergenic