ID: 1018065514

View in Genome Browser
Species Human (GRCh38)
Location 6:160122745-160122767
Sequence CCACCTCAACACCATCATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018065514_1018065518 -2 Left 1018065514 6:160122745-160122767 CCTCAATGATGGTGTTGAGGTGG 0: 1
1: 0
2: 2
3: 13
4: 138
Right 1018065518 6:160122766-160122788 GGCCTGGAATTGCCCTGGCTTGG No data
1018065514_1018065523 17 Left 1018065514 6:160122745-160122767 CCTCAATGATGGTGTTGAGGTGG 0: 1
1: 0
2: 2
3: 13
4: 138
Right 1018065523 6:160122785-160122807 TTGGAAGTGAGAATATTTGGTGG 0: 1
1: 0
2: 1
3: 34
4: 348
1018065514_1018065522 14 Left 1018065514 6:160122745-160122767 CCTCAATGATGGTGTTGAGGTGG 0: 1
1: 0
2: 2
3: 13
4: 138
Right 1018065522 6:160122782-160122804 GGCTTGGAAGTGAGAATATTTGG No data
1018065514_1018065517 -7 Left 1018065514 6:160122745-160122767 CCTCAATGATGGTGTTGAGGTGG 0: 1
1: 0
2: 2
3: 13
4: 138
Right 1018065517 6:160122761-160122783 GAGGTGGCCTGGAATTGCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018065514 Original CRISPR CCACCTCAACACCATCATTG AGG (reversed) Intronic
909491067 1:76226835-76226857 CCTCCTCACCTCCAACATTGGGG + Intronic
909720922 1:78768120-78768142 CCTCCTCAAAACCACCACTGGGG + Intergenic
913276591 1:117144321-117144343 CCTCCTCCACTCCCTCATTGAGG + Exonic
913986703 1:143572326-143572348 GCCCCTCCACACCCTCATTGTGG + Intergenic
918127679 1:181598512-181598534 CCACCCCAACTCCTTTATTGTGG - Intronic
919839976 1:201601902-201601924 CCTCCTCGACACCACCACTGAGG - Intergenic
920891206 1:209987077-209987099 CCATATCAACATCATCATTTTGG + Intronic
921265178 1:213416076-213416098 CCACCTCAACACCCTCACCCCGG - Intergenic
922845300 1:228679786-228679808 CCACCTCTACTCCCTCCTTGAGG - Intergenic
923676745 1:236086960-236086982 CGACCTCCATACCACCATTGAGG + Intergenic
923898093 1:238295061-238295083 CCACTTGCCCACCATCATTGTGG + Intergenic
924744191 1:246817531-246817553 CTACCTCAACACTGTCATTCTGG - Intergenic
1063307711 10:4921043-4921065 CCACCTTAACCCCATCAAAGAGG - Intergenic
1063322359 10:5062220-5062242 CCACCTTAACCCCATCAAAGAGG + Intronic
1063436435 10:6035865-6035887 CCACCTCACCTCCATCATTGTGG + Intronic
1067724655 10:48760897-48760919 CCTCCTCATCCCCATCATAGAGG - Intronic
1069210337 10:65750550-65750572 CCACTTCAACACTATGTTTGTGG - Intergenic
1070352209 10:75603678-75603700 TCCCCTCAACACCATTCTTGGGG + Intronic
1071382446 10:85081342-85081364 TCAACACACCACCATCATTGTGG - Intergenic
1071984371 10:91036044-91036066 CCCCTTCAACTCCACCATTGTGG + Intergenic
1076531233 10:131146542-131146564 AGACCTCAACAGGATCATTGAGG - Exonic
1076814398 10:132907717-132907739 CCACCCCAACACCATCACTGTGG - Intronic
1077250676 11:1559335-1559357 CCACCTCAACGCCACCTTTACGG - Intronic
1089025831 11:115268869-115268891 CCACCTCAACAGAATGAGTGGGG + Intronic
1089386811 11:118073803-118073825 CCTCCTCCACCCCATCATGGCGG - Intergenic
1091753618 12:3037970-3037992 AGACCTCAACACCAACATCGAGG + Exonic
1092985642 12:13843173-13843195 CCACCTCAAAAACACCATTTTGG + Intronic
1094376426 12:29794707-29794729 GGACCTCAACACCATCAGTGAGG - Intergenic
1094552898 12:31469674-31469696 ACACCTCACCTCCAACATTGGGG - Intronic
1096001615 12:48134960-48134982 TCGTCTCAACATCATCATTGTGG + Exonic
1096196055 12:49649517-49649539 GCAACTCAATGCCATCATTGCGG - Exonic
1102254373 12:111407185-111407207 CCTCCTCACCTACATCATTGTGG - Intronic
1104887085 12:132117096-132117118 CCACCTCAGCACCATCTGCGAGG - Intronic
1108206064 13:48091963-48091985 CCTCCTCAGCTCCATCTTTGGGG - Intronic
1112752351 13:102596378-102596400 CCACCTCACCCCCATCAAAGGGG + Intergenic
1113481900 13:110627445-110627467 CCACCTCATGAACAGCATTGGGG - Exonic
1114569502 14:23656701-23656723 CCACCTCAATACCATCACACTGG + Intergenic
1117492506 14:56264271-56264293 ACACTTCAACACCATGGTTGGGG - Intronic
1119917875 14:78419065-78419087 ACCCCTCAGCACCATCTTTGGGG + Intronic
1121231032 14:92358572-92358594 CCAACTTAACATGATCATTGAGG + Intronic
1121696802 14:95920233-95920255 CCTCCTGAAAACCATTATTGTGG - Intergenic
1122045987 14:99024078-99024100 CCACCTCAACTCCATGACAGTGG + Intergenic
1124214420 15:27794695-27794717 CCTTCTCTACACCATCATTTGGG - Intronic
1129013726 15:72446858-72446880 CCTGCTCAACACTGTCATTGAGG - Intergenic
1129075238 15:72989321-72989343 ACACATCAAAACCATGATTGCGG + Intergenic
1129205865 15:74036663-74036685 CCACCTGCCCACCCTCATTGAGG + Intronic
1129927277 15:79375768-79375790 CCACCTCCACTCCACCACTGGGG + Intronic
1131938674 15:97536372-97536394 CAACCTCAACATCATTATTTTGG - Intergenic
1135817916 16:25652816-25652838 CTACCTCAAGACCTTCATTCTGG + Intergenic
1141910515 16:87055467-87055489 ACACCTCAGCACCATCCTAGGGG - Intergenic
1143021770 17:3920451-3920473 ACACCTCTACACCAGCATGGTGG + Intergenic
1144182196 17:12762765-12762787 CCATCCCAACACCATCAGTGAGG - Intronic
1148105517 17:45116691-45116713 CCACCTCTGCACCATCCTGGGGG - Exonic
1148857231 17:50585453-50585475 CCACCTCTCCACTGTCATTGGGG - Intronic
1149394955 17:56230878-56230900 CCACCTCACCCCCACCAATGGGG - Intronic
1151195918 17:72430974-72430996 CCAGCTCAACACCAGCAATAAGG + Intergenic
1152916117 17:83036971-83036993 CCTCCTCAGCACCCTCATTTTGG - Intronic
1153479864 18:5536358-5536380 TCACATCAACACCATCATTAAGG + Intronic
1153574605 18:6508000-6508022 CCACATCATCACCATTATTAGGG - Intergenic
1153626201 18:7024426-7024448 CCACTTCATCTCCATCATTGAGG + Exonic
1160116226 18:76081884-76081906 CCACTTTCACACCAGCATTGGGG - Intergenic
1161287177 19:3474678-3474700 CCACCCCACCTCCCTCATTGGGG - Exonic
1163381124 19:16969499-16969521 TCACCTCAACACCATCACCTCGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925701482 2:6643087-6643109 ACCCCCCAATACCATCATTGTGG + Intergenic
926611996 2:14956238-14956260 CCACATCACTACCAACATTGCGG + Intergenic
928169782 2:28995873-28995895 CCACCTCAGGACCATCCATGGGG - Intronic
934612379 2:95750815-95750837 CCACATCATCACCAGCATTTGGG - Intergenic
934841774 2:97628632-97628654 CCACATCATCACCAGCATTTGGG + Intergenic
935544389 2:104385492-104385514 GCACCTCAGCACTACCATTGAGG + Intergenic
942812250 2:180013220-180013242 CCACCCCACCCCCAGCATTGAGG + Intergenic
944187709 2:196967848-196967870 CCACCCCACCTCCAGCATTGGGG - Intronic
944348079 2:198692695-198692717 CCACCTCCCCACCATCCCTGGGG - Intergenic
945691735 2:213044935-213044957 CCCCCTCAACAACTTCATTGAGG + Intronic
947140975 2:227019061-227019083 CCACCTCAACATCAAAATTGAGG - Intronic
947196484 2:227573311-227573333 CAACTCCACCACCATCATTGAGG - Intergenic
947550700 2:231043602-231043624 CAACCTCTCCACCATCATTTTGG + Intronic
1168819821 20:765345-765367 CTACCTCACCACCTTCTTTGTGG - Exonic
1170299467 20:14867079-14867101 CCACCTAAACACGATCCTTGAGG - Intronic
1171433316 20:25100846-25100868 CCTCCTCCACTCCCTCATTGTGG - Intergenic
1175087306 20:56470679-56470701 CCACCTCACCCCCATCCTTCAGG + Intronic
1175283199 20:57819336-57819358 CCACCACCCCACCATCTTTGTGG - Intergenic
1175582408 20:60110915-60110937 CCTCCTCAGCACCCTCACTGAGG - Intergenic
1176668899 21:9713559-9713581 CCACCCCGACACCCTCCTTGCGG - Intergenic
1179040169 21:37795833-37795855 CCACCTCAAAAACATTCTTGAGG - Intronic
1179149803 21:38800104-38800126 CCACCTCAACACCATCACCTCGG - Intergenic
1179609295 21:42539503-42539525 CCACCTCAGTGGCATCATTGGGG + Exonic
1181976380 22:26733570-26733592 CCACCTGAACCCCAGCATTCAGG + Intergenic
1182328944 22:29536623-29536645 CCGCCTCAACAGCATCATGCAGG - Exonic
1182669545 22:31984231-31984253 CCACCCCAACACCCTCAGAGAGG - Intergenic
1183084964 22:35481058-35481080 CCAGCTCAGCACCCTCACTGTGG - Intergenic
1184116636 22:42426334-42426356 CCACCTCAGCACCTGCAATGGGG + Intronic
950066039 3:10112700-10112722 CCACTTCAACAGCATCACTTAGG + Intergenic
950182674 3:10926515-10926537 CCATCCCAACCCAATCATTGAGG + Intronic
951947773 3:28161063-28161085 ACACCACAACACAATAATTGTGG + Intergenic
954871981 3:53774293-53774315 CCACCCCAGCATCATCACTGGGG + Intronic
955231819 3:57106046-57106068 CTACCCTAACACCATCATAGTGG + Intronic
959411474 3:106028974-106028996 ACACCTCACCTCCATCATAGGGG - Intergenic
960766783 3:121139661-121139683 TAACCTCATCACCATCATTTAGG + Intronic
962305074 3:134278829-134278851 CTACCACAAGACCATCATAGGGG - Intergenic
962306396 3:134290532-134290554 CCACCTCATCATCCTCATTCTGG - Intergenic
968648696 4:1752007-1752029 GCACCTCATCACCAGCATTGGGG - Intergenic
969224060 4:5782907-5782929 TCTCCTCAAAACCATCATTAGGG - Intronic
969519316 4:7666531-7666553 CCACCTCACCACCAACAAGGTGG + Intronic
977414978 4:96721663-96721685 CCGCCTCTACACCTTCATTCAGG - Intergenic
978932258 4:114329441-114329463 ACAGCTCAACAGTATCATTGGGG + Intergenic
985405884 4:189637954-189637976 CCACCCCAACACCCTCCTTGCGG + Intergenic
985818960 5:2147042-2147064 CCACCTCCTCACCATCATGTTGG + Intergenic
985923843 5:3000449-3000471 CTTCCTCCACACCATCACTGAGG + Intergenic
986318513 5:6608316-6608338 CTACCTCAACAACCTCATTCTGG + Intronic
987135751 5:14897928-14897950 CCACCTTCACAGCATCATAGAGG + Intergenic
987761723 5:22172271-22172293 GCACCTCAACAGCATCATCAAGG + Intronic
991301535 5:65133421-65133443 CCACATCATCCCCATCTTTGAGG - Intergenic
991896508 5:71405710-71405732 GCACCTCAACAGCATCATCAAGG + Intergenic
992891923 5:81211571-81211593 GTGCCTCAACACCATCACTGTGG - Intronic
994813429 5:104553332-104553354 CCACCTCAACAACACTTTTGTGG + Intergenic
999192245 5:149757001-149757023 CCACCTCAGCATCATCCTTCAGG + Intronic
1000098249 5:157989864-157989886 GCTCCTCAACACCATCATCAAGG - Intergenic
1005341165 6:24845205-24845227 CCACCACACCAACAACATTGTGG - Intronic
1007475083 6:42114263-42114285 CCACCTCACCACCATGCTTGCGG + Intronic
1007914383 6:45547206-45547228 CAGCGTCAACACCATCATTCTGG - Exonic
1013398788 6:109770902-109770924 CCACCTCAGCACCATCTTCTGGG - Intronic
1015995118 6:138988702-138988724 CCACGTAGACACCAACATTGAGG + Intergenic
1018065514 6:160122745-160122767 CCACCTCAACACCATCATTGAGG - Intronic
1018406871 6:163494738-163494760 CCACCTCAGCACTATGCTTGAGG - Intronic
1018846529 6:167560675-167560697 CAACCTCAGCACCACCTTTGTGG - Intergenic
1024009937 7:45258946-45258968 CCACCTCCACACCACCCTTCTGG - Intergenic
1026622914 7:71966374-71966396 CCACCCCACCTCCATCACTGAGG - Intronic
1027944839 7:84731578-84731600 ACCCCTCAACACCATCCATGAGG + Intergenic
1031372114 7:120981099-120981121 CCACCTCACCACCTTCCTTTTGG + Intergenic
1033533000 7:142285039-142285061 CCACCTCAACACCATCCCATTGG - Intergenic
1034785727 7:153924406-153924428 CCTCCTCAAAACCCTCAATGAGG - Intronic
1041300194 8:56403583-56403605 CCACCTCAATACTATCACTTTGG - Intergenic
1041756196 8:61315612-61315634 CCAGCTCTACAACATCATAGTGG + Intronic
1044598254 8:93979234-93979256 TCACCCCAAACCCATCATTGAGG - Intergenic
1046496960 8:115026394-115026416 ACAACTAAACACCATCATTCTGG - Intergenic
1049122745 8:140754184-140754206 CCACCTGAACCCCTTCCTTGAGG - Intronic
1051378998 9:16436195-16436217 CCACAGCTCCACCATCATTGGGG + Exonic
1061622047 9:131817078-131817100 CCACGACAACCCCATCAATGGGG + Intergenic
1061880581 9:133566964-133566986 CCACCTCGACGCCATCATAGCGG - Exonic
1203656967 Un_KI270753v1:7376-7398 CCACCCCGACACCCTCCTTGCGG + Intergenic
1185432724 X:18939-18961 CCCGCTCACCACCATCATTCAGG + Intergenic
1185440789 X:226643-226665 CCCGCTCACCACCATCATTCAGG + Intergenic
1185442075 X:231761-231783 CCCGCTCACCACCATCATTCAGG + Intergenic
1187334973 X:18374016-18374038 CCTCCTCAACAACTTTATTGAGG + Intergenic
1190797502 X:53759037-53759059 CCACCTCAAGATCTTCAATGTGG + Intergenic
1190917639 X:54822103-54822125 CCACCTCAAGATCTTCATCGTGG - Intergenic
1192102925 X:68284355-68284377 ACACCTCACCTCCAACATTGGGG - Intronic
1197714988 X:129700147-129700169 CCACCTTAATACCATCATCTTGG + Intergenic
1198028559 X:132732570-132732592 CCACCACAACAACAGCATAGGGG - Intronic
1198379053 X:136067116-136067138 CCACACCAATACCCTCATTGTGG - Intergenic
1199402729 X:147418263-147418285 CCACCTCACCCCCATCATTAAGG - Intergenic
1200144345 X:153918828-153918850 TCACCTCATCCCCATCATGGGGG + Exonic
1200601364 Y:5209558-5209580 CCACCACAACATCATCACTAGGG + Intronic