ID: 1018067145

View in Genome Browser
Species Human (GRCh38)
Location 6:160132119-160132141
Sequence AGGCCACCGCACCACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018067145_1018067146 -6 Left 1018067145 6:160132119-160132141 CCAGGACAGTGGTGCGGTGGCCT 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1018067146 6:160132136-160132158 TGGCCTCCGACTGTGACCCTTGG 0: 1
1: 0
2: 1
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018067145 Original CRISPR AGGCCACCGCACCACTGTCC TGG (reversed) Intronic
900183074 1:1320901-1320923 TGCCCACCACCCCACTGTCCCGG + Intronic
900374408 1:2346932-2346954 AGGCCACCGTCCCGCTGGCCAGG + Intronic
900683399 1:3931479-3931501 AGGACACTGAACCACTCTCCAGG - Intergenic
900777648 1:4596604-4596626 AGGACACAGCACCACAGTCGGGG - Intergenic
902389219 1:16092960-16092982 AGGCCCCCGCCCCACAGCCCAGG - Intergenic
902817163 1:18922937-18922959 AGGCCACCCCATCCCTGCCCAGG + Intronic
905919610 1:41710724-41710746 AGGACACAGCACCAGTGCCCAGG - Intronic
906108509 1:43308483-43308505 AGTCCCCCACTCCACTGTCCTGG - Intronic
906667594 1:47632463-47632485 AGGTCCCAGCACCTCTGTCCTGG + Intergenic
907130994 1:52096834-52096856 AGGCCACTGCACTACAGCCCAGG + Intergenic
909815155 1:79983494-79983516 ACGCCACTGCACTACTGTCTAGG + Intergenic
915373585 1:155372651-155372673 AGGCCACTGCACCCCAGTCTGGG - Intronic
918252730 1:182718120-182718142 GGGCCAAAGCACCTCTGTCCTGG + Intergenic
920043763 1:203120617-203120639 CTGCCACCCCACCACTGTCTGGG - Intronic
920057176 1:203201309-203201331 AGGCCACCGCATCTCTTGCCTGG - Intergenic
923072693 1:230580389-230580411 AGGCCACTGCACCCCAGTCTCGG - Intergenic
923524370 1:234760660-234760682 AGGCCAGGGCACCACAGTGCAGG + Intergenic
1063067999 10:2628870-2628892 AGGCCTCTCCACCAATGTCCAGG + Intergenic
1065749577 10:28873673-28873695 AGGCCACAGGACCTTTGTCCTGG - Intronic
1065774053 10:29102921-29102943 AGGGCACCGCAGGCCTGTCCGGG + Intergenic
1067468942 10:46522511-46522533 TGGCAACTGCACCACTGTCTAGG - Intergenic
1070105651 10:73428267-73428289 AGGCCATGGCTCCACGGTCCCGG - Exonic
1070834351 10:79438539-79438561 TGGCCAGCCCAGCACTGTCCTGG - Intronic
1073060671 10:100731593-100731615 CGACCACCCCACCACTGCCCTGG + Intergenic
1075898556 10:126019601-126019623 AGACCACTGCACCCCTGTCCTGG + Intronic
1076593761 10:131610985-131611007 AGGCCACAGCTCCACTTTTCTGG - Intergenic
1076739393 10:132475584-132475606 AGGTCCCCTCTCCACTGTCCTGG + Intergenic
1076793229 10:132787397-132787419 CGGCGGCCGCACCACTGCCCCGG - Intergenic
1076796112 10:132799243-132799265 AGGACACCGCACCTGTGCCCGGG + Intergenic
1077118275 11:895243-895265 AGGCCATCCCACCACCATCCTGG - Intronic
1077148928 11:1059850-1059872 AAGCCACCGCTCGGCTGTCCCGG - Intergenic
1077356764 11:2122347-2122369 AGGGGACCGCACCACAGACCTGG - Intergenic
1077528029 11:3079735-3079757 ATGCCACCGCACCCCAGTCTGGG + Intergenic
1079699089 11:23520876-23520898 AGGCCACTGCAGCTCTGTGCTGG + Intergenic
1080930804 11:36808059-36808081 AGGCAACAGCACTACTGTCTTGG - Intergenic
1083205289 11:61145224-61145246 AGGACACTGCCCCACTGTGCGGG + Intronic
1084194519 11:67516840-67516862 TGGCCTCAGCACCACTCTCCTGG - Intergenic
1084698926 11:70773153-70773175 AGGCAACCACACTACTGGCCTGG + Intronic
1084966439 11:72747064-72747086 AAGCCACCCCAGCACTGGCCTGG + Intronic
1086385377 11:86302123-86302145 AGGGCACCGCGCCAGTTTCCGGG - Intergenic
1088651295 11:111959621-111959643 AGGCAAAGGCACCACTGGCCAGG + Intronic
1090338506 11:125993238-125993260 TGGCCACCTCACCACTGTAGGGG + Intronic
1091604458 12:1938074-1938096 TGGCCCCCGCACCACAGTCATGG + Intergenic
1093878149 12:24374187-24374209 AGGCTTCTGCACCACTGCCCTGG - Intergenic
1094071826 12:26424800-26424822 AGGCCACTGCACTACTGCCTGGG - Intronic
1094476820 12:30846894-30846916 AAGCCACCTCAACCCTGTCCAGG + Intergenic
1097112837 12:56674781-56674803 AGGCCACCGCACCCCAGCCTGGG + Intronic
1098528225 12:71511274-71511296 GTGCCAGTGCACCACTGTCCAGG - Intronic
1101976530 12:109364369-109364391 ACGCCACCACACCCCAGTCCTGG - Intronic
1104566509 12:129889738-129889760 AGGCCTCTGGACTACTGTCCTGG - Intronic
1105383224 13:19906616-19906638 ATGCCACTGCACCACAGTCTGGG - Intergenic
1108340800 13:49496454-49496476 AGGGCGCCCCTCCACTGTCCTGG - Intronic
1108522920 13:51261182-51261204 AGGTCACTGCACCCCTGCCCAGG - Intronic
1109010033 13:56928630-56928652 ATGCCACTGCACCACAGTCAGGG + Intergenic
1109650115 13:65313667-65313689 AGGCCACAGCACCATTGCTCTGG + Intergenic
1110236594 13:73223407-73223429 ATGCCACCTCTCCACGGTCCTGG - Intergenic
1112665858 13:101572411-101572433 AGGCCCCGGCACCACTGTACAGG + Intronic
1113899624 13:113788926-113788948 AGGCCACCGACCGACTGCCCTGG + Intronic
1118480051 14:66155482-66155504 AGGCCACAGCAGCACTGTCTGGG - Intergenic
1119374145 14:74175427-74175449 AGGCCACCATACTCCTGTCCAGG + Intronic
1120964285 14:90153910-90153932 AGGCCACCTAGCCTCTGTCCTGG + Intronic
1122835586 14:104429324-104429346 AGGGCACCTCACCACTGTCAAGG - Intergenic
1202885909 14_KI270722v1_random:106991-107013 AGGCCACAGCAGCAGTGTTCTGG + Intergenic
1202886386 14_KI270722v1_random:111332-111354 AGTCCACAGCAGCAGTGTCCTGG + Intergenic
1125601146 15:40916352-40916374 AGGCCCCAGCATCACTGCCCAGG - Intergenic
1127994660 15:64146192-64146214 AGGCCACCCCACCACTTTGACGG - Intergenic
1130273382 15:82463995-82464017 AGGCCACGTCACCACTGCTCTGG - Intergenic
1130465733 15:84191366-84191388 AGGCCACGTCACCACTGCTCTGG - Intergenic
1130486958 15:84403444-84403466 AGGCCACGTCACCACTGCTCTGG + Intergenic
1130498532 15:84482170-84482192 AGGCCACGTCACCACTGCTCTGG + Intergenic
1130588022 15:85195962-85195984 AGGCCACGTCACCACTGCTCTGG - Intergenic
1142468294 17:148100-148122 AGGCCACAGCCCCTCTTTCCTGG - Intronic
1144831365 17:18133131-18133153 AGGCCACCACACTACTGGTCAGG + Intronic
1146257304 17:31398990-31399012 AGGCCGGGGCACCATTGTCCAGG - Intronic
1146346417 17:32063031-32063053 AGGGCACCGCACCACTAGTCCGG + Intergenic
1147414166 17:40276476-40276498 ATGCCACCGCACCCCAGTCTGGG + Intronic
1147768523 17:42852300-42852322 AGGCCCCCGCTTCAGTGTCCAGG + Exonic
1147771112 17:42868232-42868254 AGGCCCCCGCTTCAGTGTCCAGG + Intergenic
1148602502 17:48905097-48905119 AGGCCACCGCACTCCAGTCTGGG + Intergenic
1203158142 17_GL000205v2_random:24142-24164 AGACCACAGCAGCACTGTTCTGG + Intergenic
1156538498 18:37887050-37887072 AGGTCACAGCACTACTTTCCTGG + Intergenic
1160941659 19:1622905-1622927 AGGCCCCAGCCCCACAGTCCAGG - Intronic
1161576254 19:5056076-5056098 AGCCCTCCTCAACACTGTCCAGG - Intronic
1163296015 19:16413249-16413271 AGGCCACTGCAACTCTGTGCTGG + Intronic
1163364483 19:16868468-16868490 AGCCTCCCACACCACTGTCCTGG - Intronic
1167883369 19:52480851-52480873 ACGCCACCGCACCCCAGTCTGGG + Intronic
1202661312 1_KI270708v1_random:73971-73993 AGGCCACAGCAGCAGTGTTCTGG + Intergenic
927920913 2:26971086-26971108 TGGCCACCGCACCTCTGCCCTGG + Intronic
930007372 2:46908988-46909010 AGGCCACTGGACCACAGCCCGGG + Intronic
930910015 2:56619778-56619800 AGCCCACCCCACCACTATCAGGG + Intergenic
931669082 2:64630699-64630721 GGGCCACCACACCACTGGCAAGG - Intergenic
932915203 2:75850372-75850394 AGGCCACCGCACTCCTGCCTGGG + Intergenic
937955527 2:127420016-127420038 AGGCCACCCCACCCCTACCCCGG + Intronic
941004957 2:160238398-160238420 ATGACACCGCAGCACTGTCCTGG - Intronic
942821407 2:180120141-180120163 AAGCCACCCCCCCACTCTCCAGG - Intergenic
944076808 2:195742136-195742158 AGTCCACCCCTCCACTGCCCTGG - Intronic
945948070 2:216013401-216013423 CGGCCACCGCGCCAGCGTCCAGG + Exonic
947165256 2:227255203-227255225 AGCCCACTGCCCCACTGGCCTGG - Intronic
947952365 2:234159406-234159428 AAGCCACCCCACCTCTGGCCTGG - Intergenic
948613371 2:239183717-239183739 TCCCCACCGCACCCCTGTCCTGG + Intronic
1168765984 20:381720-381742 AGGGCACCCCAGCCCTGTCCCGG - Intronic
1172811705 20:37652781-37652803 ATGCCACCGCACCACAGCCTGGG - Intergenic
1175675776 20:60945612-60945634 AGGCCACTGCCCCATTGGCCTGG + Intergenic
1178998289 21:37428066-37428088 AGGCTACCGAACCTCTGTCTGGG - Intronic
1179046729 21:37851181-37851203 AGGCAACCACACCACTTCCCTGG - Intronic
1179606444 21:42518673-42518695 AGGACACCTCAGCACTGTTCTGG - Intronic
1179885637 21:44313187-44313209 AGACCACCTCACCACCGTGCGGG - Intronic
1180742763 22:18065226-18065248 AGCCCACCCTGCCACTGTCCTGG - Intergenic
1184034927 22:41913816-41913838 AGGGCACCGGGTCACTGTCCAGG - Intronic
1184688587 22:46107437-46107459 AGGCCTCCGCACACCTGTCCTGG + Intronic
1185251342 22:49803231-49803253 CGGCCACCGCACCACCGCACGGG + Intronic
1185341628 22:50293669-50293691 AGGCTGCCCCACCACGGTCCGGG - Intronic
950426518 3:12927488-12927510 AGGCCACCGCTGCAGTGACCAGG + Intronic
954366291 3:50147924-50147946 AGGCCACGCCACCGCTGTCATGG + Intergenic
954583622 3:51716901-51716923 GTGCCACCACACCTCTGTCCTGG - Intronic
955993129 3:64649850-64649872 AGGCCACCCCACCATTGTAATGG + Intronic
956007876 3:64799778-64799800 ACCCCACCACACCTCTGTCCTGG + Intergenic
956787726 3:72656162-72656184 AGGCAAGCTGACCACTGTCCTGG - Intergenic
966830166 3:184001208-184001230 ATGCCACCGCACTACAGTCTGGG + Intronic
966843083 3:184105372-184105394 AGGCCACCGCAAAGTTGTCCAGG + Exonic
966908407 3:184544135-184544157 AGGGCACTGCAGCACTGCCCTGG - Intronic
967145009 3:186599098-186599120 AGTCCACCTCACCACCGGCCAGG - Intergenic
968081446 3:195849411-195849433 TGGCCACCTCACCAGTGTCATGG - Intergenic
968632006 4:1656646-1656668 AGGACATCGCACCACAGGCCCGG + Intronic
972763743 4:42132285-42132307 AGGCCACCACACCACTCCCTTGG + Intronic
978131349 4:105201782-105201804 AGGCCACTGCACCGCAGTCTGGG - Intronic
988595415 5:32585943-32585965 AGGCCGCCGCCGCATTGTCCCGG - Intronic
991324512 5:65415896-65415918 AGGCCACTGCAGCTCTGTGCTGG + Intronic
999837084 5:155385746-155385768 AGACCATCACACCACTGCCCAGG - Intergenic
1002064711 5:176646309-176646331 AGGCCACCTCACCTCCTTCCTGG - Exonic
1002081575 5:176740637-176740659 AGGCCTCTGCTCCTCTGTCCTGG - Intergenic
1014535599 6:122610256-122610278 GGGCCACCGCATCACTCCCCGGG - Intronic
1017747442 6:157459651-157459673 AGGCCACCCCACCACCTGCCAGG - Intronic
1018067145 6:160132119-160132141 AGGCCACCGCACCACTGTCCTGG - Intronic
1018617662 6:165703246-165703268 AGGGAACAGGACCACTGTCCTGG - Intronic
1018691333 6:166346468-166346490 AGAAGACCGCACCAGTGTCCAGG + Intergenic
1018841909 6:167523509-167523531 AGCCCAGCCCACCTCTGTCCTGG - Intergenic
1019191736 6:170255099-170255121 AGGCCATGGCACCAGAGTCCGGG - Intergenic
1019860686 7:3655911-3655933 TGGCCACCTCACCAGTGTCTGGG + Intronic
1023972385 7:45000507-45000529 AGCCCACCTGACCATTGTCCGGG - Intronic
1024292222 7:47812985-47813007 AGGTCAGCGCACCACTGCCAGGG - Intronic
1028588505 7:92473774-92473796 AGAAGACCGCACCAGTGTCCAGG + Intronic
1030527088 7:110667369-110667391 ATGCCGCCCCACCACCGTCCTGG + Intronic
1031038019 7:116809096-116809118 ATGCCAACGCACCCCTTTCCGGG + Intergenic
1031989490 7:128188466-128188488 GGGCCAGCACACCAGTGTCCTGG + Intergenic
1038224804 8:25645829-25645851 TGGCCACAGAGCCACTGTCCCGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1049803754 8:144529874-144529896 AGGCCCCGGGCCCACTGTCCTGG + Exonic
1056364618 9:85891859-85891881 AGGCCACCGCACTCCAGTCTGGG - Intergenic
1056558483 9:87709558-87709580 ATGCCACCGCACCACAGCCTGGG - Intergenic
1057363564 9:94397690-94397712 AGTCCTCCTCAACACTGTCCAGG - Intronic
1057696222 9:97324677-97324699 AGGCCACAGCAACACTGGCCTGG - Intronic
1060524822 9:124314531-124314553 ATGCCACTGCACTACAGTCCAGG - Intronic
1061875093 9:133539643-133539665 TGGCCCCCGCACGGCTGTCCCGG + Intronic
1062636503 9:137494344-137494366 AGGCAGCTGCACGACTGTCCTGG + Intronic
1203493070 Un_GL000224v1:125076-125098 AGGCCACAGCAGCAGTGTTCTGG - Intergenic
1203495562 Un_GL000224v1:148060-148082 AGACCACAGCAGCACTGTTCTGG + Intergenic
1203498438 Un_GL000224v1:175355-175377 AGGCCACAGCAACAGTGTTCTGG + Intergenic
1203508187 Un_KI270741v1:89983-90005 AGACCACAGCAGCACTGTTCTGG + Intergenic
1203510991 Un_KI270741v1:117604-117626 AGGCCACAGCAACAGTGTTCTGG + Intergenic
1188388665 X:29592777-29592799 AGCCCCCCTCACCAATGTCCTGG + Intronic
1201112754 Y:10812381-10812403 AGGCCACCGCACTCCTATCTTGG - Intergenic
1202369497 Y:24187349-24187371 AGGCCACATCACCACTGCTCTGG + Intergenic
1202501288 Y:25482768-25482790 AGGCCACATCACCACTGCTCTGG - Intergenic