ID: 1018067218

View in Genome Browser
Species Human (GRCh38)
Location 6:160132459-160132481
Sequence GTGGGGTCAAGGAGCTTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018067202_1018067218 28 Left 1018067202 6:160132408-160132430 CCAGGTCTCAGGGTAGAATGGGA 0: 1
1: 0
2: 0
3: 15
4: 201
Right 1018067218 6:160132459-160132481 GTGGGGTCAAGGAGCTTGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 117
1018067211_1018067218 1 Left 1018067211 6:160132435-160132457 CCTAACGTGGGTAGGGGGTTGTT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1018067218 6:160132459-160132481 GTGGGGTCAAGGAGCTTGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018067218 Original CRISPR GTGGGGTCAAGGAGCTTGCG GGG Intronic
900545587 1:3227400-3227422 TGGGGGTCAAGGAGCTTGCCCGG - Intronic
901738666 1:11328293-11328315 GTGCCGTCAAGGAGCATGTGGGG - Intergenic
902923512 1:19680886-19680908 GAGGGGCCATGGTGCTTGCGGGG + Intergenic
904801048 1:33093155-33093177 GAGGGGTCAGGGAGCCTGTGGGG + Intronic
905104918 1:35558479-35558501 GAGGAGGCAAGGAGCCTGCGGGG + Intronic
905546323 1:38803019-38803041 GTGGGGATAAGGAGCTTGCAGGG + Intergenic
915568144 1:156728290-156728312 ATGGTGTCAAGGTCCTTGCGTGG - Exonic
920420297 1:205828601-205828623 GTGAGGTCAAGGGGCCTGCTGGG - Exonic
923104210 1:230842108-230842130 GTGGTTGCCAGGAGCTTGCGGGG + Intronic
924025967 1:239833292-239833314 GAGCAGTCAAGGAGCTTGCTTGG - Intronic
924715190 1:246566561-246566583 GTGCTGTCACGGAGCTTGCTCGG - Exonic
1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG + Intronic
1070278300 10:75029284-75029306 GTGAGCCCAAGGAGCTTGCTGGG + Exonic
1071774496 10:88770142-88770164 GTGGGGTCTTGGAGCTTCTGGGG - Intronic
1076279998 10:129238334-129238356 CTGGGGTCAAGGAGCAGGGGAGG - Intergenic
1076784958 10:132745217-132745239 GTGGCCTCCAGGAGCTCGCGAGG - Intronic
1077457792 11:2691421-2691443 GTGGGGGCAGGGAGCTTCAGTGG - Intronic
1078345631 11:10545139-10545161 GTGGGGGCAAGGGGCTTCCTGGG + Intergenic
1085044990 11:73347474-73347496 GTGGGGTCAGGGAGGTTTCCTGG + Intronic
1087083410 11:94193745-94193767 CTGGGGTCATGGAGTTTGCTGGG + Intergenic
1087242764 11:95798158-95798180 GTGGGGACAAAGAGCTTAGGAGG - Intronic
1088810441 11:113388126-113388148 TTGGGCCCAGGGAGCTTGCGAGG + Intronic
1088917013 11:114235123-114235145 GTGGGGAGAAGAAGCTTTCGGGG + Intronic
1089281810 11:117379997-117380019 ATGGGGCCAGGGTGCTTGCGGGG + Intronic
1090079700 11:123603681-123603703 GTGAGGTCAGGGAGCTCGAGGGG + Intronic
1090226747 11:125076384-125076406 GTGGGGGCAGGGAGTTTGAGTGG - Intronic
1098803584 12:74993047-74993069 GTGAGGTCAAGGAGCTGAAGAGG + Intergenic
1099390941 12:82078045-82078067 GTGGGGTCTGGGATGTTGCGGGG + Intergenic
1102603819 12:114053441-114053463 GTGGAATGAAGGAGCTTGCTTGG - Intergenic
1104213501 12:126713336-126713358 GTGGAGAAAAGGAGCTTGCTAGG - Intergenic
1106583577 13:31037966-31037988 GTGTGTGCAAGGAGCTTGCATGG + Intergenic
1111347214 13:86974544-86974566 GTGGGGGCAGGGAGCTTCCTGGG - Intergenic
1118759888 14:68874058-68874080 GTGGGGTCAAGGATGGTGTGGGG - Intergenic
1118791165 14:69094326-69094348 GGTGGGTCAGGGAGCTTGGGTGG - Intronic
1122623883 14:103074438-103074460 CTGGGGTCACAGAGCTTGTGAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1126064142 15:44812182-44812204 GTGGGGGCAGGGAGCTGGAGAGG + Intergenic
1129410334 15:75347508-75347530 GTGGGGTCCCCGAGCTTGGGGGG - Intronic
1130977640 15:88789554-88789576 GTGGGTTCAGGGAGCTTGCCAGG - Intergenic
1135279166 16:21138970-21138992 GTGGGGTCAAGTAGCTATAGAGG + Intronic
1136224109 16:28847003-28847025 GTGAGGTCAGGCAGCTTGCGGGG + Intronic
1141623385 16:85248926-85248948 GTGGAGTCCTGGAGCTTCCGGGG + Intergenic
1142034691 16:87855803-87855825 GTGGGTTCATGGGGCCTGCGGGG - Intronic
1142365361 16:89647150-89647172 CTGGGGACAAGGAGCGTGTGTGG - Intronic
1143163324 17:4885339-4885361 GTGGGGTAAAGGAGGGTGCTGGG + Intronic
1144638294 17:16924541-16924563 CTGGGGTCAGGGAGCTTTCAGGG + Intergenic
1144821252 17:18076243-18076265 ATGGGGTCCAGGAGCATGCATGG - Intergenic
1147754887 17:42761500-42761522 GTGGGGTCAGGGACCGTCCGAGG - Intronic
1148554951 17:48572885-48572907 GCGAGGTCAAGGGGCTTCCGAGG + Intronic
1152640043 17:81445521-81445543 GTGGGGTGGGGGAGCTGGCGGGG - Exonic
1153561516 18:6376078-6376100 GTGGGGTCGGAGAGCTTGAGGGG - Intronic
1157794085 18:50559591-50559613 GTGGGGAGAAGGAGCCGGCGGGG - Intergenic
1162004342 19:7767708-7767730 ATGGGGTCAGGGAGGTTGGGGGG - Intronic
1163491826 19:17621214-17621236 GTGGGGTCAAGAAGGGTGTGTGG - Intronic
1163663867 19:18594195-18594217 GTGGGGACAGGGAGCTGGGGGGG - Intronic
1164683104 19:30149151-30149173 GTGGGGTCAAGGGGCTAAGGGGG + Intergenic
1165358251 19:35317435-35317457 GTGGGGTCCAGGAGCTGGGTGGG - Intergenic
1166795285 19:45422092-45422114 GTGTGGGCAAGGAGCTGGTGAGG - Intronic
1167064737 19:47176371-47176393 GTGGGGACAAGGTGCTTGGCTGG + Intronic
1167635033 19:50649361-50649383 GTGGGGAGAAGGAGCTGGGGTGG + Intronic
1202652986 1_KI270707v1_random:23708-23730 GTGGGGGCAGGGGGCTTGCTGGG - Intergenic
926811249 2:16757054-16757076 GTGGGGTCAAGGGGCCCGGGTGG + Intergenic
927276460 2:21266486-21266508 GTGAGGTCAGGGATCTTGCTTGG + Intergenic
929814676 2:45221474-45221496 GTGGGGTCTAGGAGTAGGCGGGG - Intergenic
937108038 2:119337369-119337391 GAGGGGTTAAGAAGCTTGCCTGG - Intronic
941366956 2:164621353-164621375 GTGGGGAGAAGGGGTTTGCGCGG + Exonic
943782990 2:191845610-191845632 CTGGGGACAGGGAGATTGCGTGG - Intronic
944310190 2:198224563-198224585 GAGAGGTTAAGGAGCTTGCCTGG - Intronic
946495497 2:220192069-220192091 GTGGGGGCAAGGGGCTTCCTGGG - Intergenic
948159561 2:235812932-235812954 GTGAGGTCAATTAGCTTGCAGGG - Intronic
1175018986 20:55824447-55824469 GAGGGGTGAAGGGGCTTGCCAGG - Intergenic
1175822842 20:61919924-61919946 GTGGTGTCACGGTGATTGCGTGG + Intronic
1175822854 20:61920071-61920093 GTGGTGTCACGGTGATTGCGTGG + Intronic
1176269390 20:64227790-64227812 CTGGGGTCACAGAGCTTGAGGGG + Intronic
1176599164 21:8775943-8775965 GTGGGGGCAGGGGGCTTGCTGGG + Intergenic
1178665689 21:34544366-34544388 GTGGCCTCAAGGAGCTAGAGTGG + Intronic
1182753565 22:32660549-32660571 CTGGGGTTAAGGGGCTGGCGGGG + Intronic
952378758 3:32788199-32788221 GTTGGGTCAAGGAGCCTACTTGG + Intergenic
953917263 3:46927935-46927957 GAGAGGTCAAGGAGCATGGGGGG + Intronic
954030972 3:47819764-47819786 GGGGGGTCAAGGAGGTAGGGAGG - Intronic
956614090 3:71153499-71153521 GTGGGGTCAAGATGATTGCGGGG - Intronic
957587398 3:82149764-82149786 AAGGGGTGAAGGAGCTTGCTTGG + Intergenic
958117947 3:89246548-89246570 GTTGTGTCAAAGAGCTTGCAAGG + Intronic
969624088 4:8293647-8293669 GGGGGGTCAAGGAGCTCCCCTGG + Intronic
969672808 4:8598934-8598956 TTGGGGGCACGGAGCCTGCGTGG + Intronic
974165587 4:58197335-58197357 GTGGGGTCAAGCAGGTTTGGAGG + Intergenic
975488626 4:74964056-74964078 GTGGTGTCAGGGAGTTTGAGTGG + Intronic
984296554 4:177861670-177861692 GTGGGGGCAAGGGGCTTCCTGGG - Intronic
984872751 4:184341642-184341664 GAGGGGTTAAGAAGCTTGCTCGG - Intergenic
985797292 5:1972530-1972552 GTGGGGAACTGGAGCTTGCGGGG + Intergenic
985931749 5:3063846-3063868 GTGGAGTGAAAGAACTTGCGGGG + Intergenic
986339256 5:6775462-6775484 GTGGGGTCCAGGAACTTCAGGGG + Intergenic
997365962 5:133325335-133325357 GTGGGGTCAAGGTGGGTGGGGGG + Intronic
997605612 5:135173802-135173824 GTGGAGTCAAGGAGCTGCCTGGG - Intronic
1001747075 5:174100103-174100125 CTGGGGTCATGGAGCATGTGGGG + Intronic
1008654077 6:53593468-53593490 GTGGGGTGAAGGAACTAGCTAGG - Intronic
1012137481 6:95577455-95577477 GCGGGGTCACGGAGCGGGCGGGG - Intergenic
1013721057 6:113028452-113028474 GCGGAGTCAAGGAGGTTGCCGGG + Intergenic
1014957424 6:127638218-127638240 GTGGGGCCAAAGAGCTTGCTGGG - Intergenic
1017602909 6:156102933-156102955 ATGGAGTCAAGTAGCTTGGGGGG - Intergenic
1018067218 6:160132459-160132481 GTGGGGTCAAGGAGCTTGCGGGG + Intronic
1020100188 7:5390028-5390050 GTGGGCCCAAGGAGCCTGTGGGG + Intronic
1022523541 7:31022926-31022948 GTGGGATCAAGGAGGCTGAGGGG + Intergenic
1026165066 7:67902337-67902359 GCAGGGCCAAGGAGCTTGCAAGG - Intergenic
1028862973 7:95675402-95675424 GCAGAGTCAAGGAGCTTGAGTGG - Intergenic
1030981201 7:116186714-116186736 GTGGGAGCAAGGAGCTTTCTGGG + Intergenic
1031224677 7:119021071-119021093 TTTGGGTCAAGGAGTTTGGGAGG - Intergenic
1037535178 8:19817199-19817221 GTGAAGTCAGGGAGCATGCGCGG - Exonic
1038202022 8:25421752-25421774 GTGGGGTCAAGGGGGATGTGGGG + Intronic
1043954361 8:86343124-86343146 GTGGGGTCACGGGTCTTGCCCGG + Intronic
1049285745 8:141774283-141774305 GTGTGGTCAAGGTGCTGGCTAGG + Intergenic
1049354977 8:142183108-142183130 GTGAGGGGAAGGGGCTTGCGGGG + Intergenic
1049376755 8:142293014-142293036 GTGGGGTCCTGGAGCTTTCTGGG - Intronic
1050154448 9:2650977-2650999 GTGTGATCAAGGAGCTTGTATGG + Intronic
1055973382 9:81932933-81932955 ATGGGTTCACGGATCTTGCGGGG - Intergenic
1055975136 9:81948025-81948047 GTGGGTTCACGGATCTTGCGGGG - Intergenic
1059320391 9:113464060-113464082 GTGGTGTCCAGCAGCTTGCTTGG - Intronic
1062529139 9:136992303-136992325 GCGGGCTTAGGGAGCTTGCGCGG - Intergenic
1062567116 9:137168309-137168331 GTGGGGTCAAGGGGCAGACGGGG - Exonic
1062717101 9:138016535-138016557 GTGGGGTCCAGGTGCTTGCCGGG + Intronic
1186434113 X:9528671-9528693 GGGGAGTGCAGGAGCTTGCGGGG + Intronic
1186776414 X:12869060-12869082 GAGAGGTTAAGGAGCTTGGGTGG + Intronic
1189575505 X:42348834-42348856 GTGGGAGCAAAGAGCTTGTGGGG + Intergenic
1189757191 X:44283501-44283523 GTGGAGTCAAAGTGCTTCCGGGG - Intronic
1191767069 X:64709699-64709721 GTGGGGTGCAGGAGCTTGGGTGG + Intergenic
1192230091 X:69258636-69258658 GTAGGGTCAACGAGCTGGCATGG + Intergenic
1200047682 X:153411408-153411430 GGGGGGGCATGGAGCATGCGCGG - Intergenic
1201594806 Y:15656349-15656371 GTGAAGTCAAGGAACTTGAGAGG + Intergenic