ID: 1018067499

View in Genome Browser
Species Human (GRCh38)
Location 6:160134111-160134133
Sequence GGCCTCACCAGTAGTAGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018067499_1018067510 8 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067510 6:160134142-160134164 TGCCTACGGGGAAGGGGCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 133
1018067499_1018067512 20 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067512 6:160134154-160134176 AGGGGCGCCGGCCACCCCTCTGG 0: 1
1: 0
2: 5
3: 9
4: 254
1018067499_1018067506 1 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067506 6:160134135-160134157 TTCCTCCTGCCTACGGGGAAGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1018067499_1018067507 2 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067507 6:160134136-160134158 TCCTCCTGCCTACGGGGAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 162
1018067499_1018067502 -4 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067502 6:160134130-160134152 GGCCCTTCCTCCTGCCTACGGGG 0: 1
1: 0
2: 0
3: 16
4: 187
1018067499_1018067505 0 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067505 6:160134134-160134156 CTTCCTCCTGCCTACGGGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 195
1018067499_1018067500 -6 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067500 6:160134128-160134150 GAGGCCCTTCCTCCTGCCTACGG 0: 1
1: 0
2: 2
3: 27
4: 247
1018067499_1018067501 -5 Left 1018067499 6:160134111-160134133 CCTGCTCTACTACTGGTGAGGCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018067501 6:160134129-160134151 AGGCCCTTCCTCCTGCCTACGGG 0: 1
1: 0
2: 1
3: 31
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018067499 Original CRISPR GGCCTCACCAGTAGTAGAGC AGG (reversed) Exonic
900679478 1:3908780-3908802 GGCCTCCCCAGCAGCCGAGCAGG - Intergenic
902269114 1:15290329-15290351 AGCCTCACCAGCAGAAGAGCTGG + Intronic
902710906 1:18239069-18239091 GGCCCCAACAGTAGTAGCTCAGG - Intronic
909103623 1:71381428-71381450 GGCCTCACCAGAAGGTGAGCAGG - Intergenic
912039087 1:105362733-105362755 GGCCTCACCAGAAGCCAAGCAGG + Intergenic
913259793 1:116987808-116987830 GGCCTCACAACTACTGGAGCAGG - Exonic
913330348 1:117662074-117662096 GGCCTCACCAGAAGCTAAGCAGG + Intergenic
915672350 1:157500366-157500388 GGCCCTACCAGTTGTAAAGCAGG - Intergenic
917565477 1:176207819-176207841 GGAATCACCATCAGTAGAGCAGG - Intergenic
922145545 1:222940234-222940256 GGCCTCGCCAGAAGCTGAGCTGG - Intronic
922812754 1:228426940-228426962 GCCCTCACCAGAAGCAGAGGTGG + Intergenic
923044653 1:230346837-230346859 TGCCTCTCCAGTAGGAGAGATGG - Intronic
1063984702 10:11490069-11490091 GGCCTCACCGGAATTGGAGCTGG - Intronic
1064175193 10:13068625-13068647 GGCCTCACCAGTTGTGAAGCAGG - Intronic
1065112681 10:22455312-22455334 GGCCCCAGCAGAAGTAGAGGTGG - Intergenic
1068224409 10:54088007-54088029 GGCTTCCCCAGAAGCAGAGCAGG + Intronic
1068722415 10:60260809-60260831 GGCCTCCCCAGGAGCCGAGCTGG + Intronic
1070409477 10:76126161-76126183 GGCCACACAAGTCCTAGAGCAGG - Intronic
1071435116 10:85641766-85641788 GGCCAGACCAGCAGTAAAGCTGG + Intronic
1071789716 10:88941221-88941243 GGCCTCACCAGTAGTAACGAAGG + Exonic
1071880303 10:89889933-89889955 GCCCTCACCAGAAGCTGAGCAGG + Intergenic
1075808645 10:125208550-125208572 GGCCACACCAGGAGCAGAGACGG + Intergenic
1078134683 11:8641922-8641944 GGCCTCCCCAGAAGCCGAGCAGG + Intronic
1087306700 11:96498187-96498209 GGCCTCCCCAGAAGCTGAGCAGG - Intronic
1088123152 11:106393578-106393600 GGCCTCCCCAGAAGTTGAGCAGG - Intergenic
1088924105 11:114283154-114283176 GGCATTCCCAGTAGTAGAACTGG - Intronic
1090634465 11:128682129-128682151 GGGCACTCCAGTAGGAGAGCAGG - Intergenic
1091224033 11:133946981-133947003 GACATCACCATTAGGAGAGCAGG + Intronic
1091625756 12:2119546-2119568 TCCCTCACCAGTAGTAGTGCAGG - Intronic
1097107663 12:56634937-56634959 GGCCTCACCTGGAGCAGGGCCGG + Intronic
1097708769 12:62895817-62895839 GCCCTCATCAGAAGTGGAGCAGG + Intronic
1098567700 12:71954311-71954333 TGCCTCACCAATAATAGCGCAGG + Intronic
1098954096 12:76670633-76670655 GGGTTGATCAGTAGTAGAGCCGG - Intergenic
1101316278 12:103632139-103632161 GGCCACACAACTAGGAGAGCTGG + Intronic
1102667922 12:114591977-114591999 GGAAGCACCACTAGTAGAGCTGG + Intergenic
1103611256 12:122125606-122125628 GGCCTCACCGGTGGTACAGCAGG - Intronic
1105970592 13:25426221-25426243 GGCCTCACCAGAAGCAGATGCGG - Intronic
1106067735 13:26372686-26372708 TGGCTCATCAGTAGCAGAGCTGG - Intronic
1107230267 13:38101210-38101232 GGCCTCACTGGAAGCAGAGCTGG - Intergenic
1107298727 13:38942627-38942649 GGCCTCACCAGAAGCTGAGCAGG + Intergenic
1109502585 13:63256791-63256813 GGCCTCTCCAGAAGCTGAGCAGG - Intergenic
1111291605 13:86178360-86178382 GGCCTCCCCAGGAGCTGAGCAGG - Intergenic
1112396054 13:99033208-99033230 GGCAGGACCAGTAGTAGAGAAGG + Intronic
1112647825 13:101355148-101355170 GGCCTCATCAGAAGCTGAGCAGG + Intronic
1117165493 14:53028642-53028664 GCCCTCACCAGAAGCTGAGCAGG + Intergenic
1117784270 14:59266304-59266326 GCCCTCAGTGGTAGTAGAGCTGG + Intronic
1118258232 14:64223797-64223819 GGCCTCACCAGACTTAGGGCAGG + Intronic
1118804510 14:69223925-69223947 GGCCTCACCAGAAGCAGATGTGG - Intronic
1118999423 14:70868615-70868637 GGCCTCACCAATTGTGAAGCAGG + Intergenic
1120842139 14:89095329-89095351 GGCCTCTCCAGCAGGATAGCTGG + Intergenic
1121244062 14:92450017-92450039 GCCCAGACCAGTAGGAGAGCAGG + Intronic
1121552806 14:94815043-94815065 GGCCTGGCCAGGAGGAGAGCTGG + Intergenic
1123766027 15:23479098-23479120 GGACTTACCAGTTGTACAGCAGG - Intergenic
1125916614 15:43493319-43493341 GCCCTCCCCTTTAGTAGAGCCGG + Intronic
1127550569 15:60033695-60033717 GGCCTCGCCAGAAGCTGAGCAGG + Intronic
1130856592 15:87844538-87844560 TGCCTCAGCAGTTGCAGAGCAGG - Intergenic
1130949014 15:88571115-88571137 GGCCTCACCCATAGAAGAGGTGG - Intergenic
1131080665 15:89531949-89531971 GCCCTCACCAGGAGGTGAGCTGG + Intergenic
1131785324 15:95906003-95906025 GGCCTCATCAGAAGCTGAGCAGG + Intergenic
1134258520 16:12631076-12631098 GGCCCCACCAGCAGCAGCGCTGG - Intergenic
1135077478 16:19406548-19406570 GGCCTTACCAGTTGTGAAGCTGG + Intergenic
1135923558 16:26672559-26672581 GGCCTGGGCAGTAGGAGAGCAGG + Intergenic
1137671809 16:50283664-50283686 GACCACCCCAGTGGTAGAGCAGG - Intronic
1140634323 16:76893478-76893500 GACCTCACCATTGGGAGAGCAGG + Intergenic
1143471513 17:7178621-7178643 GGGCTCACCAGGACTAGAGTGGG + Intronic
1145276969 17:21437342-21437364 GGCCTCACCAGGAGTGGACTTGG - Intergenic
1145314799 17:21723235-21723257 GGCCTCACCAGGAGTGGACTTGG - Intergenic
1145713241 17:26995172-26995194 GGCCTCACCAGGAGTGGACTTGG - Intergenic
1149667025 17:58372087-58372109 GACATCAACAGTAGTAGAGGGGG - Intronic
1151470317 17:74313959-74313981 GCCCTCACCAGCCGCAGAGCTGG + Intronic
1151902233 17:77024012-77024034 GGCCTCCCCAGAAGTAAAGCAGG + Intergenic
1152108894 17:78346154-78346176 CAGCTCACCAGGAGTAGAGCTGG - Intergenic
1155694511 18:28669498-28669520 AGCATCACCAGTAGTAGATGAGG + Intergenic
1156971630 18:43163724-43163746 GGCCTTACCAGTTGTAAAGTTGG - Intergenic
1161344682 19:3762188-3762210 GGATTTAGCAGTAGTAGAGCTGG + Intergenic
1161498422 19:4599604-4599626 GGCCTGACCAGTTGCACAGCTGG - Intergenic
1164657917 19:29938235-29938257 GGCCTCACCAGAAACCGAGCAGG - Intronic
1166426245 19:42680939-42680961 GGCCTCCTCAGAAGCAGAGCAGG + Intronic
1166739165 19:45103829-45103851 GGCCACACAGGTAGTAGAGGAGG + Intronic
1167925498 19:52818184-52818206 GGCTTCTCCAGGAGTAGAGTGGG - Intronic
1168315062 19:55481427-55481449 GGCCTCGCTGGTGGTAGAGCAGG - Exonic
1168556847 19:57350711-57350733 GGCCTCACCAGAAGCAGATACGG + Intergenic
925246735 2:2390193-2390215 GGCCTCCCCAGAAGCTGAGCAGG - Intergenic
925294352 2:2767654-2767676 TGCCTCAGCAGCAGCAGAGCCGG - Intergenic
930081895 2:47457394-47457416 GGCCTCCCCAGAAGCTGAGCAGG - Intronic
932316003 2:70783485-70783507 AGCCTCTGCAGTAGCAGAGCAGG - Intronic
933131231 2:78676439-78676461 GGCCTTACCAGTTGTGAAGCTGG + Intergenic
933706341 2:85293459-85293481 GGCCTCCCCAGGAGCCGAGCAGG + Intronic
934905374 2:98196588-98196610 CGCCTGCCCAGTAGTTGAGCGGG + Intronic
936492593 2:112985233-112985255 GGCCTCAGAAGCAGGAGAGCTGG + Exonic
937224920 2:120363240-120363262 GGCCTCACCTGAGGCAGAGCTGG + Intergenic
938163843 2:129009412-129009434 GGCCTCTGCAGGAGTGGAGCAGG + Intergenic
938422149 2:131154432-131154454 GGACTCGGCAGTAGTAGAGGAGG - Intronic
942839077 2:180337706-180337728 GGCCTTACCAGTTGTGAAGCTGG - Intergenic
942980119 2:182070794-182070816 GGCCTCCCCAGAAGCCGAGCAGG - Intronic
947397611 2:229701937-229701959 GGCCAAACCAGTTGTAGAGACGG + Intronic
1168988214 20:2069973-2069995 GGCCTCACCAGACGTCAAGCAGG - Intergenic
1169916455 20:10688525-10688547 GAGCTCAGCAGTAGCAGAGCTGG - Intergenic
1169929265 20:10815046-10815068 GGCATCACTAGTATCAGAGCTGG - Intergenic
1170725133 20:18919365-18919387 GGCCTCACCAGAAACTGAGCAGG + Intergenic
1172359391 20:34301725-34301747 GGTCACATCAATAGTAGAGCTGG - Intronic
1173503923 20:43572305-43572327 GGTCTCAGCAGTCCTAGAGCTGG - Intronic
1173593719 20:44245477-44245499 GGCCTCACCAGAAGCCAAGCAGG - Intergenic
1173914650 20:46697996-46698018 GGCCTCACCAGAAGCAGATGTGG - Intergenic
1177155094 21:17493486-17493508 GGCCTTACCAGTATCAGAGCAGG + Intergenic
1182956262 22:34429549-34429571 TCCCTCACCAGTATTTGAGCAGG + Intergenic
1183656371 22:39187503-39187525 GGCCTGACCAGAAGCTGAGCAGG + Intergenic
1185267800 22:49913612-49913634 GGTCTTGCCAGTGGTAGAGCAGG + Exonic
949948087 3:9206288-9206310 GGCTTCCTCAGTAGTAAAGCAGG - Intronic
953828880 3:46278245-46278267 CACCACACCAGTAGTAGAGATGG - Intergenic
954087382 3:48256160-48256182 GGCCTCCCCAGTAGCAATGCTGG - Intronic
954760551 3:52870718-52870740 CGCCTCACCAGCAGCAGGGCAGG + Intronic
954970589 3:54648733-54648755 GCCCTCAACAGAAGCAGAGCAGG - Intronic
955612927 3:60776582-60776604 GGCCTTACCAGTTGTGAAGCTGG - Intronic
957447295 3:80330200-80330222 GGCCTCAGCAGAAGCTGAGCAGG + Intergenic
962469821 3:135696524-135696546 CACCTCACAAGTGGTAGAGCTGG + Intergenic
963818282 3:149858136-149858158 GCCCTCACCAGAAGCTGAGCAGG + Intronic
964920280 3:161887714-161887736 GGCCTCACCAGAAGACAAGCAGG - Intergenic
966688182 3:182719089-182719111 GGCCTTACCAGTTGTGAAGCAGG + Intergenic
969338821 4:6527868-6527890 GGCCCCAGCAGGAGGAGAGCGGG + Intronic
971455920 4:26843794-26843816 GGCCTCCCCAGAAGCTGAGCAGG - Intergenic
978024898 4:103861005-103861027 GGCCTCCCCAGAAGCCGAGCAGG + Intergenic
980722642 4:136717808-136717830 GGCCTTACCAGTTGTGAAGCTGG - Intergenic
982450859 4:155550797-155550819 GGCCTCCCCAGCTGTAGAGGAGG - Intergenic
982477936 4:155875947-155875969 GGCCTTACCAATTGTGGAGCAGG + Intronic
983539184 4:168890255-168890277 GGCCTCACCAGAAGTTCAGGAGG + Intronic
984274391 4:177591965-177591987 AGCCTCCCAAGTAGTAGAGACGG - Intergenic
985572881 5:659616-659638 GGCTACACCAGTGCTAGAGCAGG + Intronic
987890152 5:23865553-23865575 GGCCTTACCAGTTGTGAAGCAGG - Intergenic
988635249 5:32976831-32976853 GCCCTCACCAGAAGCAGAGGCGG + Intergenic
988963004 5:36388078-36388100 GGCCTTTCAAGAAGTAGAGCAGG - Intergenic
997719245 5:136064791-136064813 GGACTGACCAGCAGTAGTGCTGG - Intergenic
1004887620 6:20066920-20066942 GGCCTCCCCAGAAGCTGAGCAGG - Intergenic
1007588620 6:43008051-43008073 GGCCTCACCTGTAGAAGATGTGG - Exonic
1008189757 6:48439814-48439836 GGCCTCATCAGGAGCTGAGCAGG + Intergenic
1008932870 6:56958042-56958064 GGCCTCCCCAGCATTAGGGCAGG + Intronic
1014811863 6:125895650-125895672 GGCCTCAACAGAAGCAGAGATGG - Intronic
1018067499 6:160134111-160134133 GGCCTCACCAGTAGTAGAGCAGG - Exonic
1018425219 6:163673865-163673887 GGCCTCCCCAGAAGCAGAGCAGG - Intergenic
1019844407 7:3482631-3482653 GACCTCCCCAGTAGGATAGCAGG - Intronic
1019943997 7:4312293-4312315 GGCCTCCCCAGAAGTCAAGCAGG + Intergenic
1023255709 7:38310516-38310538 GGCATCACTAGTAGCAGAGAAGG - Intergenic
1024581565 7:50805066-50805088 GGTCTCACCAGTGGTCGAGCAGG - Intergenic
1026249600 7:68657970-68657992 GGCTTCACCAGAAGCTGAGCAGG - Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029481737 7:100817454-100817476 GGCCTCACCAGTTGCAAGGCAGG - Intronic
1031920543 7:127597365-127597387 ATCCTCACCAATAGTAAAGCTGG + Intronic
1032319837 7:130875877-130875899 GGCCTCATCAGGAGCCGAGCAGG - Intergenic
1032770910 7:135054958-135054980 GCCCTCACCAGAAGCTGAGCAGG - Intronic
1034878451 7:154745634-154745656 GGCCTCACCAGAAGCTAAGCAGG - Intronic
1036098916 8:5756072-5756094 CGCCTCACCAGAAGCTGAGCAGG - Intergenic
1038533968 8:28340697-28340719 GGCCTCACCAGAAGCAGATGCGG - Intronic
1042606086 8:70548134-70548156 GCCCTCACCAGAAGCTGAGCAGG + Intergenic
1048175803 8:132151126-132151148 GGCCTTACCAGTTGTGAAGCTGG - Intronic
1048523925 8:135183670-135183692 GGCCTCCCCAGGAGGTGAGCAGG + Intergenic
1049843969 8:144791068-144791090 CGCCTCAACAGCAGTAAAGCAGG + Intronic
1050498903 9:6273284-6273306 GGCAGGACCTGTAGTAGAGCAGG - Intergenic
1052067915 9:24045484-24045506 GGCCTCTCCAGCAGGTGAGCTGG + Intergenic
1057149416 9:92783192-92783214 GGCGTCACCAGAAGCAGAGAGGG - Intergenic
1058177524 9:101754889-101754911 GGCCTCACCAGCAGCCAAGCAGG - Intergenic
1058855389 9:109056934-109056956 TGCCTCTCCAGTAGTCCAGCTGG + Intronic
1059008713 9:110433131-110433153 GGCCTCCCCAGAAGCTGAGCAGG + Intronic
1059119776 9:111631489-111631511 GGCCGCACCAGCAGCAGCGCCGG - Exonic
1060052019 9:120384415-120384437 GGCCTCACCAGGAGCAGGGCTGG + Intergenic
1062145746 9:134988760-134988782 GGCCTCTCCAGAAGCTGAGCAGG - Intergenic
1186257227 X:7735746-7735768 CGCCTCTCCAGAAGCAGAGCAGG - Intergenic
1187568293 X:20474812-20474834 GGCCTCCCCAGAAGCTGAGCAGG + Intergenic
1189017213 X:37296765-37296787 GGCCTCCCCAGAAGCTGAGCAGG - Intergenic
1189616782 X:42792429-42792451 GGCCTTACCAGTTGTGAAGCAGG + Intergenic
1190731241 X:53227448-53227470 GCCCTCACCAGGAGTGGAGGAGG + Intergenic
1192165853 X:68827402-68827424 GGACACACCAGTAGTCTAGCTGG - Intergenic
1193282354 X:79668506-79668528 GGCCTCTCCAGAAGCTGAGCAGG - Intergenic
1196218135 X:113079645-113079667 GGCCTCAACAGCAGAAGAGAGGG + Intergenic
1196890827 X:120289060-120289082 GGCCTCAACAATAGGACAGCTGG + Intronic
1197384306 X:125784933-125784955 GGCTTTACCAGTAGTGAAGCAGG + Intergenic