ID: 1018067731

View in Genome Browser
Species Human (GRCh38)
Location 6:160135385-160135407
Sequence TGAAGGGCAAAGAACTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018067728_1018067731 23 Left 1018067728 6:160135339-160135361 CCAAACAAGGTGTTAATCATATT 0: 1
1: 0
2: 2
3: 14
4: 172
Right 1018067731 6:160135385-160135407 TGAAGGGCAAAGAACTCCACAGG 0: 1
1: 0
2: 0
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018067731 Original CRISPR TGAAGGGCAAAGAACTCCAC AGG Intronic
901852801 1:12026715-12026737 TGAAGGGCAAAGGAGTCAGCGGG - Intronic
903509696 1:23865973-23865995 TGAAGGAGAAAGAGCTCTACTGG + Intronic
907366645 1:53966397-53966419 TAAAGGGCAAAAAACTTCAAAGG - Intronic
908157641 1:61371333-61371355 TGAAGGAAAAAAAAATCCACTGG - Intronic
910410025 1:86933177-86933199 TGAAGCTCAAAGAACTCAAGAGG - Intronic
910994690 1:93091496-93091518 TGATGGACAAACAACTCCAGAGG - Intronic
916246603 1:162694424-162694446 GGTGGGGGAAAGAACTCCACAGG - Intronic
916391618 1:164337270-164337292 TGAAGGGAAATGAACACCACAGG + Intergenic
921655489 1:217730989-217731011 TGAAGGCCAAAATAGTCCACAGG - Intronic
921902493 1:220465663-220465685 TAAAGGGCAAATAATTCCAATGG + Intergenic
922342938 1:224672052-224672074 TAAAGCACAAAGAGCTCCACTGG - Intronic
924288735 1:242514879-242514901 TCAAGGACAAAGACCTCCATGGG + Intronic
1066179524 10:32946441-32946463 TTAAGGGGAAAGAATTCTACTGG + Intronic
1067296070 10:44975662-44975684 TGAAGGGAAAGGAATTCCCCTGG + Intronic
1067693758 10:48520787-48520809 TGAGGGGCGAAGAGCTCCAAAGG + Intronic
1073467510 10:103702866-103702888 TGAGGGGCAAAGCAGTCCTCTGG - Intronic
1076496131 10:130898913-130898935 TTAAGGGAAATGAAGTCCACTGG - Intergenic
1080577018 11:33609333-33609355 TGAAGGGCAGCGAAGGCCACTGG + Intronic
1082737880 11:56876526-56876548 TGAAGGGAAAAGATTTCCAAGGG + Intergenic
1085989826 11:81828218-81828240 TAAAGGGCAAAGAACAGCATAGG + Intergenic
1086400907 11:86460293-86460315 TGAAGGGAAGAGAGCTCCCCAGG - Intronic
1086514846 11:87599926-87599948 TGAGGTCCAAAGAACTTCACTGG + Intergenic
1090520870 11:127477536-127477558 TTAATGGCAAAGAACTCCTATGG - Intergenic
1091630174 12:2154114-2154136 TGGAGGAAAAAGAACTCCTCTGG - Intronic
1091856919 12:3747852-3747874 AGAAGGGCACAGAGCTCCACAGG + Intronic
1091856928 12:3747890-3747912 AGAAGGGCACAGAGTTCCACAGG + Intronic
1091856937 12:3747928-3747950 AGAAGGGCACAGAGCTCCACAGG + Intronic
1091856946 12:3747966-3747988 AGAAGGGCACAGAGTTCCACAGG + Intronic
1091856955 12:3748004-3748026 AGAAGGGCACAGAGTTCCACAGG + Intronic
1091856964 12:3748042-3748064 AGAAGGGCACAGAGTTCCACAGG + Intronic
1092675183 12:10909379-10909401 AGAAGGAAGAAGAACTCCACTGG - Exonic
1092820726 12:12350969-12350991 TGAATGGAAAAGAACTGCATAGG + Intergenic
1098489777 12:71061761-71061783 GGGAGAGCAAAGAACTCCAGAGG + Intronic
1101662216 12:106775605-106775627 TGAAGTGGAAAGAACTAAACTGG - Intronic
1101824002 12:108206461-108206483 AGCAGGGCAAAGAATACCACAGG - Intronic
1102506688 12:113388536-113388558 TGAAGGGCGAGGTGCTCCACTGG - Exonic
1103783603 12:123415770-123415792 TGAAGGGGAAATAAATACACAGG + Exonic
1105357867 13:19676099-19676121 TGAAGGCCACAGAATGCCACAGG + Intronic
1106621488 13:31374755-31374777 TGAAGGAGAAGGAGCTCCACAGG - Intergenic
1106898581 13:34331552-34331574 ATAAGGGCAAAGAACTTCAATGG + Intergenic
1108061213 13:46535221-46535243 TGCAGAGCAAAGAACTCTTCAGG - Intergenic
1110047657 13:70850806-70850828 TTAAGGGAAAAGGACCCCACTGG - Intergenic
1110485912 13:76041839-76041861 TGAAGTGCAGAAAACTCCCCAGG + Intergenic
1110726140 13:78826735-78826757 TGAAGGGCAATGAAGCCTACTGG - Intergenic
1112878304 13:104073668-104073690 TGAAGGCCAATGACCTTCACTGG - Intergenic
1113442572 13:110340690-110340712 CGAAGCACAAAGAACTGCACAGG + Intronic
1113634224 13:111909061-111909083 TGAAGGATCAAGAAGTCCACTGG + Intergenic
1113863678 13:113507785-113507807 TGAAGGGCCTGGAACACCACAGG - Intronic
1114315867 14:21509428-21509450 TGAATGGGAAAAGACTCCACAGG + Intronic
1114393823 14:22338549-22338571 TTAAGGGCACAGTCCTCCACAGG - Intergenic
1118612662 14:67553763-67553785 TGAAGGTCAAGGAACTCCTCTGG + Intronic
1122979735 14:105186045-105186067 TGTGGGGCACAGAAGTCCACTGG + Intergenic
1123950476 15:25267730-25267752 TAAAGGTTAAAGATCTCCACAGG - Intergenic
1124113775 15:26820134-26820156 GGAAGGTCAAACAACTCCATAGG + Intronic
1127463987 15:59226021-59226043 TTAAGGGCAGAGAACTCCTGGGG + Intronic
1128700931 15:69803770-69803792 TGAAATGTAAAGAACTGCACGGG + Intergenic
1131447149 15:92509888-92509910 CCAAGGGCAAAGTTCTCCACTGG + Intergenic
1133630350 16:7614464-7614486 TGAAGATCAAAAAACCCCACAGG - Intronic
1133968965 16:10553464-10553486 GGAAGGGCAAAGCACTGCACCGG - Intronic
1136176525 16:28520889-28520911 TGAGGGTCAAAGAAGTGCACTGG - Intergenic
1139256145 16:65544512-65544534 TGGAGGGTAAAGAAATCCCCTGG + Intergenic
1140629962 16:76839855-76839877 TGATGGGGAGAGAAATCCACAGG - Intergenic
1143188018 17:5022282-5022304 TGCAGGGCAAAGACCCCCGCTGG + Exonic
1144095237 17:11894455-11894477 TGATGGGAGAGGAACTCCACGGG - Exonic
1148835599 17:50464151-50464173 TGTAGGTGAAAGGACTCCACTGG + Intronic
1151620367 17:75241272-75241294 GGAATGGCAAAGAACTCCCTTGG + Intronic
1152087676 17:78230691-78230713 GGAAGGTGAAAGAACTCAACAGG - Intergenic
1161743387 19:6039778-6039800 TGAAGTTCAAAGAACTCTGCAGG + Intronic
925502895 2:4526633-4526655 TGAAGGGAAAAATACTCAACTGG + Intergenic
931467320 2:62501952-62501974 TGAAGGGCCTAGAAAACCACGGG + Intronic
936437767 2:112522818-112522840 TGGAGGGCAAAGGACTCCGGAGG - Intronic
937195795 2:120155495-120155517 AGAAGCTCAATGAACTCCACAGG - Intronic
944959298 2:204852241-204852263 TAAAGAGCACTGAACTCCACTGG - Intronic
945196186 2:207239442-207239464 TCATGGGTAAAGAACTCCACTGG - Intergenic
945567430 2:211418497-211418519 TAAAGGTCAAATAAGTCCACGGG + Intronic
945574477 2:211513554-211513576 TGCAGGGCCAAGTTCTCCACAGG - Intronic
948353788 2:237361207-237361229 TGTAGAGCAAAGAAGACCACGGG - Intronic
1169041654 20:2500483-2500505 TTAAGGGCAAGGATCTCCACAGG - Intronic
1169331213 20:4717728-4717750 GGAAGGGCAGAGAACTGCAGGGG + Intergenic
1170351512 20:15447111-15447133 TGTAGGGAGAAGAACTGCACTGG - Intronic
1171247652 20:23625596-23625618 TGGAGGGCTAAGAACTTCTCTGG - Intergenic
1171843873 20:30250692-30250714 TGAAAGGCAATGAAATGCACAGG - Intergenic
1175055255 20:56192049-56192071 TGTAGGGCCATGAACTCCCCAGG + Intergenic
1175317517 20:58059368-58059390 TGCAGGGCAGAGAACTTCAGAGG + Intergenic
1178704074 21:34858505-34858527 TGAAGGCTTAAGAATTCCACTGG + Intronic
1179607692 21:42527833-42527855 TGAAAGGTAAAGAAACCCACAGG - Intronic
1181882566 22:25992543-25992565 TAAAGGGCATAGAGCTCCCCAGG - Intronic
1181971133 22:26691010-26691032 TGGAGGGCAGAAAACTCAACTGG - Intergenic
1183570265 22:38648040-38648062 TGAAGGTAAATGAGCTCCACAGG + Intronic
954739394 3:52735898-52735920 TTAAGGGGAAAGAACTCTACTGG + Intronic
955456610 3:59128607-59128629 TGAGGGGGAAAGATCTCCAAAGG - Intergenic
958842409 3:99223417-99223439 AGGAGCTCAAAGAACTCCACAGG + Intergenic
959160838 3:102722646-102722668 AGAAGGGAAAAAAAATCCACTGG - Intergenic
960143285 3:114171928-114171950 TGTGGGGCAGAGAACTCCACAGG - Exonic
960797945 3:121508170-121508192 TGAAGGGCATACAACTCGAATGG + Intronic
961372596 3:126440649-126440671 TGAAGAGGTAAGAACTCCCCAGG - Intronic
961672930 3:128548017-128548039 TGAAGGGCAGAGAACACCTTGGG - Intergenic
962149350 3:132876457-132876479 AGTGGGGCAAAGAACTCCAGGGG + Intergenic
965477383 3:169173827-169173849 TGAAGGCCAAGGAACTTCACAGG + Intronic
965614040 3:170574824-170574846 TGAAGGGCAAAGCCCTGGACTGG + Intronic
966781827 3:183590692-183590714 TCAAGTGACAAGAACTCCACAGG - Intergenic
967731061 3:192907347-192907369 TGAAGAGCAGAGAAGTCCAAAGG + Intronic
968551165 4:1223978-1224000 TGAAAGGCAAACCACTCCCCGGG + Intronic
971689820 4:29818797-29818819 TGAAGGACAAAGAAGGCCACGGG + Intergenic
971864387 4:32150548-32150570 TCATGGGCAAGGAACTCCAGAGG - Intergenic
974776084 4:66483444-66483466 TGAAAAACAAAGAACTCCAAGGG + Intergenic
975529399 4:75385389-75385411 GGAAGGATAAAGAACTCCTCAGG + Intergenic
976255107 4:83091973-83091995 TGAAGGACATAGGAATCCACTGG - Intronic
976573900 4:86646252-86646274 TGAAAGGAAAAGACCTACACTGG + Intronic
981022738 4:140046239-140046261 TGAAGGAGAAAGAGCTCCAGAGG - Intronic
985746031 5:1648311-1648333 TGCAGAGCAAAGGATTCCACAGG - Intergenic
987229540 5:15879271-15879293 TGAAGGGAAAAGAAATCTTCAGG + Intronic
989770779 5:45142696-45142718 TGTTGGGGAAAGAACTCCAAGGG - Intergenic
993685589 5:90933702-90933724 TGGAGGGCAGAGAACTTCCCGGG - Intronic
995059882 5:107802288-107802310 TGCAGTTCAAAGACCTCCACAGG - Intergenic
995328306 5:110917540-110917562 TCAAGGGCCAAGAACCCCACTGG + Intergenic
996238150 5:121159471-121159493 AGGAGGGCACAGAACTCCATAGG - Intergenic
996954271 5:129164385-129164407 TGACTGGCAGAGAGCTCCACTGG - Intergenic
1001970669 5:175952798-175952820 TAAAGGCCTTAGAACTCCACTGG + Intronic
1002246770 5:177890967-177890989 TAAAGGCCTTAGAACTCCACTGG - Intergenic
1004553950 6:16677208-16677230 TGACGAGCAAAGAACTCTGCTGG + Intronic
1004595758 6:17097981-17098003 AGAAGGGCAAAAAACTCCGAGGG - Intergenic
1008019142 6:46556180-46556202 TGTAGGACAAAGATCTCCAGAGG + Intronic
1008479359 6:51968923-51968945 TGAAGGGGAGAGGACTACACAGG - Intronic
1009376754 6:62980727-62980749 TGAAGGTACAAGAACTCAACTGG + Intergenic
1009477074 6:64106509-64106531 AGAAGAGCAAAGAATTGCACTGG - Intronic
1013178432 6:107697916-107697938 TGAAGGACAATGAACTACATCGG - Intergenic
1014182597 6:118401729-118401751 TGGATGGCAAAGAACCCCATGGG + Intergenic
1015176053 6:130310695-130310717 TGTAGGGCATAGAAATACACAGG - Intronic
1016500828 6:144718944-144718966 TGAAAGTCAAAGAAATCCACAGG - Intronic
1017961066 6:159221092-159221114 TGAAGGGCACAGCATTCCACAGG + Intronic
1018067731 6:160135385-160135407 TGAAGGGCAAAGAACTCCACAGG + Intronic
1018541942 6:164890728-164890750 TTAAGGGAAAAGAACTAAACAGG + Intergenic
1019276151 7:177071-177093 TGTTGGGAAAAGAAATCCACTGG + Intergenic
1019646406 7:2131717-2131739 TGAAGGGCACAGAGCACCCCTGG - Intronic
1020474079 7:8574580-8574602 GGAAGGCCAAACAACACCACAGG + Intronic
1024161004 7:46675943-46675965 TTTAGGGCACAGAACTACACAGG + Intronic
1025284833 7:57652796-57652818 TGCAGGACAAAGAGCTCCTCTGG + Intergenic
1026461745 7:70620735-70620757 TTTAGGGAGAAGAACTCCACTGG + Intronic
1026832321 7:73617844-73617866 TGAAGGAAAAAAAAATCCACTGG + Intronic
1027917391 7:84342863-84342885 TGAATGGCAAAGAACACTATAGG + Intronic
1028377678 7:90163281-90163303 TGAGGACCAAAGAACTCCAGTGG - Intronic
1028709362 7:93890392-93890414 GGAAGGGGACAGAACTCCCCGGG - Intronic
1029805218 7:102988959-102988981 TGAAGGGCAAGGAGCTCTCCAGG - Intronic
1029945388 7:104527457-104527479 TGAAGGGCAATGCACTCGATTGG + Intronic
1030090231 7:105851731-105851753 GAAAGGGCGAAGAAGTCCACAGG + Intronic
1030801147 7:113854012-113854034 GGAAGGGCAAAGAGATCCAGGGG + Intergenic
1031389985 7:121202217-121202239 TGAAGATCAAAGAACTCTGCTGG + Intronic
1033824478 7:145172748-145172770 TGGAAGGCAAAGAAACCCACAGG + Intergenic
1035311423 7:157971798-157971820 TGAAGCAAAAAGAACTCCCCAGG + Intronic
1037781509 8:21872417-21872439 GGAAGGGCAAAGAAGCCCTCTGG - Intergenic
1044363185 8:91311901-91311923 TGAAGGTGAAATATCTCCACAGG - Intronic
1048507748 8:135035890-135035912 TGAAGAGAAAAGGACTCCAGGGG - Intergenic
1050904362 9:10985536-10985558 AGAAGTTCAAACAACTCCACAGG - Intergenic
1052192898 9:25678558-25678580 TGAACAGCAAAGCACTCCCCGGG - Intergenic
1052378611 9:27745090-27745112 TGAAGAGCAGAGAACTTCACTGG - Intergenic
1052461988 9:28776719-28776741 TGTAAGTCAAAGAACACCACTGG + Intergenic
1054164223 9:61705153-61705175 TGAAAGGCAATGAAGTGCACAGG + Intergenic
1055347053 9:75350407-75350429 TGCAGGGGATAAAACTCCACAGG - Intergenic
1058148245 9:101435196-101435218 CGAAGGGCAAAATACTCCAAGGG + Intronic
1058759920 9:108120681-108120703 TCAAGTGCAAAGAAGTGCACAGG + Intergenic
1060739540 9:126089218-126089240 TGCAGGCCAAGGAACTCCAAGGG - Intergenic
1061268997 9:129525837-129525859 AGAAAGGAAAAGAACTCCCCAGG + Intergenic
1185433598 X:24120-24142 TTAAGGGCTAAGAACTCTAAGGG - Intergenic
1185442803 X:236188-236210 TTAAGGGCTAAGAACTCTAAGGG - Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189969806 X:46406544-46406566 TGAAGGGCTATGAACTTCACTGG + Intergenic
1190634821 X:52423488-52423510 TGAAGTGCAAAGAAATCAATGGG - Intergenic
1193062020 X:77216963-77216985 TGAAGGGCAGAGAACTTTTCAGG + Intergenic
1193158868 X:78205129-78205151 TCAAGGGCACAGAACTGGACAGG + Intergenic
1193673446 X:84418094-84418116 TGAATGGGAAAGACCTTCACCGG - Intronic
1194348829 X:92799906-92799928 AGAAGTTCAAAGAACTCTACAGG + Intergenic
1197110804 X:122771897-122771919 TGAAGAGCAGAGATCTCAACTGG + Intergenic
1198152572 X:133925355-133925377 TGGACTGCAAAGAACACCACTGG + Intronic
1200034141 X:153317535-153317557 TGCAGCCCAAAGAACCCCACAGG + Intergenic
1200665128 Y:6012720-6012742 TGATGGCCAAAGAGCTTCACTGG + Intergenic