ID: 1018069202

View in Genome Browser
Species Human (GRCh38)
Location 6:160146955-160146977
Sequence GTGTAGTTCTCTAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018069197_1018069202 29 Left 1018069197 6:160146903-160146925 CCACTGGGCCAAGGGGACTGACT 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1018069202 6:160146955-160146977 GTGTAGTTCTCTAGGGAGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 178
1018069198_1018069202 21 Left 1018069198 6:160146911-160146933 CCAAGGGGACTGACTCAAAATGT 0: 1
1: 0
2: 0
3: 23
4: 195
Right 1018069202 6:160146955-160146977 GTGTAGTTCTCTAGGGAGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018069202 Original CRISPR GTGTAGTTCTCTAGGGAGAA AGG Intronic
900555180 1:3276745-3276767 GCGCTGTTCTCCAGGGAGAAAGG - Intronic
902956875 1:19931411-19931433 CTGCAGTTCACTATGGAGAAGGG - Intergenic
905492216 1:38353453-38353475 GTGCAGTTTTCTAGGGAGAGGGG + Intergenic
908720237 1:67117626-67117648 GTGTAGTATACTAGTGAGAATGG + Intronic
908794160 1:67815085-67815107 TTCTAGTTCTCAAGGGGGAATGG + Intronic
909410481 1:75344536-75344558 GGGTACTTCTATAGGGAAAAGGG + Intronic
910604547 1:89068583-89068605 GTCTAGTTCTCAGGGAAGAAGGG + Intergenic
911647337 1:100351292-100351314 TTGTTGACCTCTAGGGAGAAAGG - Intergenic
915584712 1:156838158-156838180 TTGGAGTTCTCTGGGGAGAGAGG - Intronic
915763986 1:158344392-158344414 GTGTAGTTTGCTAAGGATAATGG + Intergenic
915956781 1:160227051-160227073 GTGCATTTTTCTGGGGAGAAGGG - Intronic
916507351 1:165440038-165440060 GTGGAGTGTTCTAGTGAGAAAGG + Intronic
917017026 1:170543879-170543901 GTGAAGTTTTGTAGGCAGAAAGG + Intronic
917799827 1:178560498-178560520 GTGAAGTTCTCTGGGTAAAATGG - Intergenic
920223024 1:204418118-204418140 GTGTATGTTACTAGGGAGAAGGG - Intergenic
1063259236 10:4366498-4366520 GTTTAGTTTTTTATGGAGAAGGG + Intergenic
1063272226 10:4523269-4523291 GTGTAATACTCTAGGTAGTAAGG - Intergenic
1066464595 10:35641128-35641150 TTGTAGTCCTCTAGGCAGATGGG + Exonic
1068280601 10:54863816-54863838 GTGAAGTTGTTTAGGGAGACTGG + Intronic
1070162942 10:73876567-73876589 TAGCAGTTCTCTTGGGAGAAGGG + Intergenic
1073585751 10:104708405-104708427 GTCTGGGTCTCTTGGGAGAAAGG - Intronic
1075355644 10:121771460-121771482 GAGTACTTATCTAGGAAGAAAGG + Intronic
1076172065 10:128327472-128327494 GTGTTGTTCCCTAGCTAGAAGGG + Intergenic
1077056416 11:596021-596043 GTGCAGGACTCTTGGGAGAATGG + Intronic
1078863540 11:15275713-15275735 GTGCATTTTTCTAGGGAGAAAGG - Intergenic
1081219519 11:40442622-40442644 GTGTGATTCTCCAGGGAGACAGG + Intronic
1082769141 11:57192376-57192398 GTGTACTTCTGTAGGTACAATGG + Intergenic
1087142180 11:94775704-94775726 GTGTTGTTCTATAGTGAGATTGG + Intronic
1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG + Exonic
1090654822 11:128835038-128835060 GGGCTGTTCTCCAGGGAGAATGG + Intergenic
1092384539 12:8026047-8026069 ATGTAGTTCTCTAACGAGGAAGG + Intergenic
1101455537 12:104826688-104826710 TTTAAGTTCTGTAGGGAGAAGGG - Intronic
1102844418 12:116163709-116163731 GTGTACTTCTCTATTTAGAAGGG - Intronic
1104231207 12:126886119-126886141 GTTTAGTTTGCTAAGGAGAATGG - Intergenic
1106258280 13:28041268-28041290 GTGTAATTCTCTCTGGACAATGG + Intronic
1106573338 13:30950709-30950731 GTGTATTTCTATAGAGTGAAGGG - Intronic
1106690815 13:32114038-32114060 TGGAAGTTCTCTATGGAGAATGG + Intronic
1106995331 13:35474795-35474817 GTGTACTTTTCAAGGGAGATAGG + Exonic
1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG + Intergenic
1107421923 13:40255207-40255229 CTGTTGCTCTTTAGGGAGAAAGG + Intergenic
1110091474 13:71454282-71454304 GTCCAGTTCCCTAGTGAGAATGG - Intronic
1110304829 13:73973567-73973589 GTGTAGCTCCCTAGAGAAAATGG + Intronic
1111753960 13:92368869-92368891 CTTTGGTTTTCTAGGGAGAAGGG + Intronic
1118487436 14:66227072-66227094 GTGCAGATCTCTAGGGAGTGAGG - Intergenic
1118640636 14:67789031-67789053 GTGAAGTTCACCAAGGAGAAAGG + Intronic
1119047556 14:71333258-71333280 GTGTAGTCGTCTTGGGATAATGG + Intronic
1121141062 14:91542462-91542484 GTGAAGTCCTCTAAGCAGAAAGG + Intergenic
1121523426 14:94601959-94601981 GTGAGGTTCTCTAGGCAGTAAGG + Intronic
1122045743 14:99021949-99021971 TTCAAGTCCTCTAGGGAGAAAGG - Intergenic
1122733875 14:103823415-103823437 GTGTTATTCTCAAAGGAGAAGGG + Intronic
1124659420 15:31533666-31533688 AGGAAGTTCTCTAGGCAGAAAGG + Intronic
1124689368 15:31809113-31809135 GTGTATCTCTCTAGTCAGAATGG - Intronic
1125031523 15:35080607-35080629 GTGTAGTTGTCTCAGTAGAAGGG + Intergenic
1125063664 15:35456384-35456406 GTGTATTTCTCTAGAGATCATGG + Intronic
1129426643 15:75468342-75468364 GTCAAGCTCTCTGGGGAGAAAGG + Exonic
1130417397 15:83706449-83706471 GTGTATTTCTTTTAGGAGAAAGG + Intronic
1132036546 15:98489897-98489919 CTGTTGGTCTCTAGGGAGGAGGG - Intronic
1132058845 15:98673704-98673726 GTGTAGTGCTCTTGGGAGCTGGG + Intronic
1136154114 16:28371295-28371317 GTCTATTTCTCTACGGAGAATGG - Intergenic
1136208978 16:28743969-28743991 GTCTATTTCTCTATGGAGAATGG + Intergenic
1139597661 16:67967885-67967907 GTGTAGATCTGTAGGGACAGTGG - Intronic
1140627162 16:76807761-76807783 GTATATTGCTCTGGGGAGAATGG + Intergenic
1140637125 16:76928174-76928196 GTGTAGTTCTGTAGGGGGGTTGG + Intergenic
1142639841 17:1279504-1279526 GGGTGGTTCTCTGGGGAGAGGGG + Intergenic
1144117421 17:12111960-12111982 GTGCAGCTCTGTAGGGAGTATGG + Intronic
1144487312 17:15677651-15677673 GTGAACTTCACTAGGAAGAATGG - Intronic
1144778064 17:17794866-17794888 CTGTGGTTCTCCAGCGAGAAGGG - Exonic
1144913721 17:18704667-18704689 GTGAACTTCACTAGGAAGAATGG + Intronic
1147026955 17:37594768-37594790 GTGTAGTTCTCTTAGAATAAAGG - Intronic
1149945668 17:60922748-60922770 GAGTATTTCTCTAAGGACAATGG + Intronic
1152643831 17:81459924-81459946 ATGTAGGTCCCTAGGGCGAAAGG + Intronic
1152800539 17:82328752-82328774 GTGGAGTTCTCTCGGCTGAAAGG - Intronic
1153697005 18:7653589-7653611 GTGTAGTTTGCTAAGGATAATGG + Intronic
1153883040 18:9437226-9437248 GTGTAATTCTCTTGGAAAAAGGG + Intergenic
1155367132 18:25059698-25059720 GTGGAGGCTTCTAGGGAGAATGG + Intergenic
1156174935 18:34532921-34532943 TTGTAGCTCTCTTGGGAGGAAGG + Intronic
1156579105 18:38354828-38354850 GAGTAGTTGTTGAGGGAGAAGGG + Intergenic
1159939619 18:74396826-74396848 CTGAAGTTCGCTAGGGCGAAGGG - Intergenic
1161901001 19:7118986-7119008 CGGTAGTTATCTTGGGAGAAGGG - Intronic
1166741362 19:45116633-45116655 CCGTGGTTCTCTGGGGAGAAGGG + Intronic
1166768120 19:45264643-45264665 GTGTAGGGCATTAGGGAGAAAGG - Intronic
1167430394 19:49450976-49450998 TTCTAGTTCTCAAAGGAGAAAGG - Intronic
925485480 2:4324293-4324315 ATTTACTTTTCTAGGGAGAAAGG + Intergenic
925628194 2:5862886-5862908 TTCTAGTTGTCTAGGGAAAAAGG + Intergenic
929582076 2:43087807-43087829 CTGTAGATCTCTAGGTATAATGG - Intergenic
930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG + Intergenic
930787817 2:55287761-55287783 CGATAGTTCTCTAGGGAAAATGG + Intergenic
931140789 2:59455490-59455512 CTGTAGTTCTCTGGAGACAATGG - Intergenic
932732859 2:74232889-74232911 GTTTGGGTCTCTGGGGAGAAGGG + Intronic
936152075 2:110027508-110027530 GTGTAGTTGTCCAGGTTGAAGGG + Intergenic
936192603 2:110343905-110343927 GTGTAGTTGTCCAGGTTGAAGGG - Intergenic
939390546 2:141563745-141563767 GTGTAATTCTCTTAGGATAATGG - Intronic
940797586 2:158096909-158096931 GTTTACTTATCTGGGGAGAAAGG + Intronic
942121677 2:172783843-172783865 GAGCAGATCTCTAGGGAGAGGGG + Intronic
944022327 2:195121422-195121444 GTGCACTTCACTGGGGAGAATGG - Intergenic
944105845 2:196078492-196078514 GAGTAGTTCTGTAGGAAAAAAGG - Intergenic
946038426 2:216763444-216763466 GAGTAGTTCTCAAGGGAGGTGGG - Intergenic
946622847 2:221577238-221577260 TTGCAGTTCTCAAGGGAGCAAGG + Intergenic
948711476 2:239828201-239828223 GTGTAATCCTCTAGGGAAAGAGG + Intergenic
1175594772 20:60222212-60222234 GTGTTCTTCTCTAGGAAGACTGG + Intergenic
1177928726 21:27252050-27252072 GAGAAGCTCTCTAGGGAGTATGG + Intergenic
1178768096 21:35473957-35473979 GTGTAGTTCTCATGAGAAAATGG - Intronic
1182147539 22:28005897-28005919 GTGTGGTTCTCTAGGGCTGAGGG - Intronic
1183370580 22:37429484-37429506 CTGGAGGTCTCCAGGGAGAAGGG - Intergenic
949881453 3:8664133-8664155 CTGTGTTTCTCTAGGGAGAGAGG + Intronic
951317877 3:21208417-21208439 GAGTATTTTTCTAGGTAGAAGGG + Intergenic
951476230 3:23109400-23109422 GTGTACTTCTCTAGGCACTATGG + Intergenic
952605691 3:35144835-35144857 TGGTAGTTCTCTGGGGATAAAGG + Intergenic
954685932 3:52370213-52370235 CTGTACCTCTCTAGGCAGAAAGG - Exonic
956387591 3:68737069-68737091 CTGTAGTTCTCTTGGTAGAACGG - Intronic
957928703 3:86849013-86849035 GTGTAGTTCTTTAAATAGAATGG - Intergenic
963885622 3:150579110-150579132 ATATAGCTCTCTAGGAAGAAAGG - Intronic
963948531 3:151172187-151172209 GTGTATTTCTTTAGGGACATTGG + Intronic
966493391 3:180552990-180553012 CTCCAGTTCTGTAGGGAGAAAGG - Intergenic
966821035 3:183924722-183924744 AGGGAGTTCTCTAGGGAGACAGG + Intronic
970178405 4:13362655-13362677 GTGGAGGTCTCTAAAGAGAAAGG + Intronic
970346895 4:15161002-15161024 TTTTAGTTGTCTATGGAGAAAGG + Intergenic
973589635 4:52427716-52427738 CTGGAGTTCTCTACTGAGAAAGG + Intergenic
975655773 4:76639693-76639715 GTAAAGTTTTCTGGGGAGAAGGG + Intronic
975924485 4:79432416-79432438 GTGTATTTGTCAAGGGGGAATGG + Intergenic
978689431 4:111488672-111488694 GTGTAGTTTGCTAAGGATAATGG - Intergenic
979944419 4:126810062-126810084 GTGAAGTTCTCAAGGAAGTATGG - Intergenic
980521310 4:133939142-133939164 GTGAAATTCTCTAAGCAGAAAGG - Intergenic
980727395 4:136781884-136781906 GTATACTGCTCTAGAGAGAAAGG - Intergenic
981967396 4:150621781-150621803 ATGTATTTCTCTTGGGAGTAAGG + Intronic
988660371 5:33260310-33260332 GTTGGGTTCCCTAGGGAGAAAGG + Intergenic
989028609 5:37093492-37093514 GTGTAGATCTATAGTGTGAAGGG - Intergenic
989495544 5:42107620-42107642 GCCTAGTTCTCTAAGGGGAATGG - Intergenic
990320742 5:54627778-54627800 ATGTAGTCCCCTAGGGAGCATGG - Intergenic
992221771 5:74580533-74580555 GTTTACTTCCCCAGGGAGAATGG + Intergenic
992327209 5:75672506-75672528 GGGGAGTTGTCTAGGGAGGAGGG + Intergenic
993874689 5:93292697-93292719 GTGTAATTCTCAAGGCAAAATGG - Intergenic
994390703 5:99189680-99189702 GTGTAGTTCTTTTGGGACAGGGG - Intergenic
996401777 5:123070429-123070451 ATGCAGTTCTCTAGGGAGAATGG + Intergenic
1000242872 5:159424801-159424823 GTGTACATTTCTTGGGAGAAGGG - Intergenic
1001326358 5:170729843-170729865 GTGTGGTTTTATAAGGAGAATGG - Intronic
1003772783 6:9325520-9325542 GTGTTTTTCTCTAGAAAGAATGG + Intergenic
1006281358 6:33056274-33056296 GTGTAGATCTATAGTGGGAAGGG - Intergenic
1007278881 6:40695705-40695727 GGGGAGTTCTCTGAGGAGAAGGG - Intergenic
1007832244 6:44647455-44647477 GTGTATTTCTCTAGGAAGAGGGG - Intergenic
1008470809 6:51882184-51882206 GTGTAGTTTTCAAGAGAGGATGG - Intronic
1008836877 6:55843543-55843565 GTTTAGTTCTTTAGCGATAAAGG - Intronic
1009616357 6:66012577-66012599 GTGAAGTTTTCAGGGGAGAATGG + Intergenic
1010658604 6:78542660-78542682 CTGCAGTTATCTAGGCAGAAAGG + Intergenic
1011260112 6:85461831-85461853 GTGGAGTTGTCTAGAGAGACTGG + Intronic
1014344890 6:120255758-120255780 ATCTGTTTCTCTAGGGAGAATGG - Intergenic
1014526967 6:122512287-122512309 GAGAAGTTCACTAAGGAGAATGG - Intronic
1015184453 6:130398239-130398261 GTGTAGTTCTCTCAGGTTAATGG + Intronic
1015825206 6:137303804-137303826 AGGTAGTTCTCCAGAGAGAAAGG + Intergenic
1018069202 6:160146955-160146977 GTGTAGTTCTCTAGGGAGAAAGG + Intronic
1018249685 6:161856623-161856645 ATGATGTTCTCTGGGGAGAAGGG - Intronic
1018888676 6:167964658-167964680 GTGTAGCTCTAGAGGGAGTAGGG + Intronic
1022377219 7:29825557-29825579 GTGTGGTTCCCAAGGGTGAAAGG - Intronic
1026943275 7:74300397-74300419 GAGTTGTTTTCTAGGGATAATGG + Intronic
1027295524 7:76765326-76765348 GTCTAGTTCTCTAGCAAGACTGG - Intergenic
1028659562 7:93253770-93253792 TTGTAGTTCACTAGTCAGAAGGG + Intronic
1031150409 7:118047542-118047564 GTGTAGTTCTCTATGGTGGGGGG - Intergenic
1032419756 7:131768623-131768645 ATGTATTTGTCTGGGGAGAAAGG + Intergenic
1033529665 7:142249048-142249070 GTGAGGCTCTCTAGGGAGATGGG + Intergenic
1037118118 8:15250653-15250675 GTGGAGTTTTGTAGAGAGAAGGG + Intergenic
1038454470 8:27663663-27663685 GAGTGGTTATCTATGGAGAATGG + Intronic
1038521572 8:28237057-28237079 ATGAAGTTCTCTAGACAGAAAGG + Intergenic
1039854768 8:41402752-41402774 GCTTGGTTCTCTAGGGAGAAAGG - Intergenic
1041402691 8:57461933-57461955 GTGTAGATCTATAGTGTGAAGGG - Intergenic
1044731826 8:95234841-95234863 GTGTTTTTCTCTTGGGATAATGG + Intergenic
1045685245 8:104704799-104704821 GAGTAGTGGACTAGGGAGAAAGG - Intronic
1046571129 8:115967577-115967599 GTGTTGTTCTATGGGGTGAAAGG + Intergenic
1047681315 8:127257382-127257404 GTGTAGTCATTTAGGGAGCATGG + Intergenic
1050531401 9:6592974-6592996 GTGTAGGTCTCAAGCGAGCAGGG - Exonic
1053143979 9:35699549-35699571 GTGGAGTGCTCTAGGGATAGGGG - Intronic
1055874347 9:80924188-80924210 GTTTAGTCTTCTAGGGAGATGGG + Intergenic
1056198825 9:84254867-84254889 CTCTAGCTGTCTAGGGAGAAAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057369565 9:94457890-94457912 GTGTAGGTCTCTAGGGAGATAGG + Intronic
1057891228 9:98871592-98871614 GTGTAGTCCTACAGTGAGAAGGG - Intergenic
1057923819 9:99124262-99124284 GAGTAGTTCACTAGGGTGGAAGG - Intronic
1058978451 9:110146696-110146718 GTGTACTTCCCTAAGGAGACTGG + Intronic
1059514451 9:114880028-114880050 GAGTGGTTTTGTAGGGAGAAAGG + Intergenic
1059753016 9:117266585-117266607 GTGTAGTTATCTAGGAGAAAAGG - Intronic
1059939875 9:119348136-119348158 CAGTAGTTATCAAGGGAGAATGG - Intronic
1186530003 X:10285936-10285958 TTGGAGTTCTCGAGTGAGAAAGG - Intergenic
1187589447 X:20700377-20700399 GTGTTTACCTCTAGGGAGAAGGG - Intergenic
1192473435 X:71419430-71419452 GTGCATTTCCCCAGGGAGAAGGG + Intronic
1195218545 X:102723922-102723944 ATATTGTTCTCTAGGGAGAGTGG + Intronic
1195906712 X:109851490-109851512 GTGTATTTTTCTTGGGAGTAGGG + Intergenic
1196981007 X:121213636-121213658 GTGGAGTTCTCAAAGGGGAATGG + Intergenic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1200857846 Y:7958746-7958768 GGGTTGTTCTCCAGGGAGTAAGG + Intergenic
1200942345 Y:8798159-8798181 GTGTAGTTATCTGGAGAAAAGGG + Intergenic