ID: 1018069870

View in Genome Browser
Species Human (GRCh38)
Location 6:160154851-160154873
Sequence CAGCCTGAAGACTATGAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018069870_1018069878 15 Left 1018069870 6:160154851-160154873 CCCCCTTCATAGTCTTCAGGCTG 0: 1
1: 0
2: 1
3: 8
4: 173
Right 1018069878 6:160154889-160154911 GCCTTGCCCCTCATTTTGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 136
1018069870_1018069883 28 Left 1018069870 6:160154851-160154873 CCCCCTTCATAGTCTTCAGGCTG 0: 1
1: 0
2: 1
3: 8
4: 173
Right 1018069883 6:160154902-160154924 TTTTGTTTGGTAAGATTTTGTGG 0: 1
1: 0
2: 2
3: 71
4: 763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018069870 Original CRISPR CAGCCTGAAGACTATGAAGG GGG (reversed) Exonic
900182513 1:1318209-1318231 CTGCCTGAAGAATATGAGTGTGG - Intronic
901120195 1:6885579-6885601 CAGCCTGAAGACGAGGGATGGGG - Intronic
902395524 1:16130475-16130497 CAGCCTCCAGCCTATGGAGGTGG + Intronic
902921246 1:19666997-19667019 AAGCCTGAAGAGTCTGAAGCAGG - Intronic
906478661 1:46186336-46186358 CAGCCTGGACCCTAGGAAGGGGG - Intergenic
908807555 1:67946808-67946830 CATTTTGAAGACAATGAAGGAGG - Intergenic
910865529 1:91784880-91784902 GAGGATGAAGACAATGAAGGGGG - Intronic
911623178 1:100090759-100090781 TAGCCAGAAGACCAGGAAGGGGG + Intronic
912393706 1:109323058-109323080 GACCCTGAAGATTATGAAGATGG - Exonic
912560370 1:110547298-110547320 CAGCCTGAGGTCTAGGAAAGAGG + Intergenic
913114701 1:115685323-115685345 CAGCCTGGAGACGCTGAATGTGG - Exonic
915472501 1:156134474-156134496 CAGGCTGCAGACCATGAAGGAGG + Exonic
916598777 1:166272316-166272338 CAAGCTGAAGACCATGAAGATGG + Intergenic
916992008 1:170254700-170254722 CAGCCTGGAGACTGGGAAGTAGG + Intergenic
917829605 1:178866168-178866190 CTGCCTTAAGACTATGAAAATGG + Intronic
920052164 1:203170864-203170886 CCTCCTGAAGACTGTGAAGAGGG - Intronic
921177762 1:212608717-212608739 CAGCCTGAGGGCTATAAAAGGGG + Exonic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
924640107 1:245825461-245825483 CAGCCTGAAGACAGAGAAGCAGG - Intronic
1064306890 10:14175495-14175517 CAAACTGGAGACTACGAAGGAGG - Intronic
1064905868 10:20344853-20344875 CAGCCTGAAGTAAATGAAAGTGG + Intergenic
1065638495 10:27754941-27754963 CAGCCTGAAGTCTAGGATAGGGG + Intergenic
1065999102 10:31087598-31087620 CAGGTTGAACCCTATGAAGGGGG - Intergenic
1066343119 10:34555850-34555872 CAGGGTGATGACAATGAAGGTGG - Intronic
1069131938 10:64715836-64715858 TAGCCTGTAGACTATGAATTTGG + Intergenic
1069454121 10:68540318-68540340 CAGCCTGAAGACCAGGGATGGGG - Intergenic
1070097543 10:73352420-73352442 TAGCCAAAAGACTATGAAAGCGG - Intronic
1070219526 10:74425581-74425603 CAGCCTGAAGTCATTGAACGTGG + Intronic
1070849516 10:79552222-79552244 CAGCCTGTAGGCTCAGAAGGGGG + Intergenic
1073664658 10:105517332-105517354 CAGCCTGAATGATATGGAGGAGG + Intergenic
1076170513 10:128315692-128315714 CATTCTGAAGGCTATCAAGGCGG + Intergenic
1076194239 10:128504148-128504170 CAACCTGAGGACAAGGAAGGAGG - Intergenic
1076274656 10:129186904-129186926 CAGTGTGAAGACCATGTAGGGGG + Intergenic
1077816845 11:5693899-5693921 CCTTCTGAAGGCTATGAAGGAGG + Intronic
1077922871 11:6654995-6655017 CAGCCTGAAGTGGATGGAGGGGG - Intronic
1081657438 11:44866765-44866787 TAGGCTGAAGCCCATGAAGGTGG - Intronic
1084930418 11:72551240-72551262 GAGCCTGAAGATTTTGAAGAGGG - Intergenic
1088051783 11:105524934-105524956 CAGCCTGAACAATATGGAGAAGG - Intergenic
1090189661 11:124759794-124759816 AAGGCAGAAGACAATGAAGGGGG + Intronic
1090848089 11:130546943-130546965 CAGCATGAAGACCACGAAGCGGG + Intergenic
1091172760 11:133532875-133532897 CTGCCTGGAGACTAGGAAGAAGG - Intergenic
1092097207 12:5852760-5852782 CAGCATGAAAACTATGATGATGG + Intronic
1092513929 12:9187931-9187953 CAGCCTGAAAACCCTGATGGGGG + Intronic
1095506085 12:42900170-42900192 CTGCCTTAAAACTATTAAGGAGG - Intergenic
1096274844 12:50197657-50197679 CAGCATGAAGACAATGACGAAGG + Intronic
1097666876 12:62488442-62488464 CTGACTGTAGAGTATGAAGGGGG + Intronic
1099240503 12:80132848-80132870 CAGGTTGAACATTATGAAGGTGG + Intergenic
1103147792 12:118610544-118610566 CAGTTTGAAGACTCTCAAGGGGG - Intergenic
1103179037 12:118891705-118891727 AGGTCTGAAGACTAGGAAGGAGG + Intergenic
1105407244 13:20142665-20142687 CAGCATGAAGATGATGAAGATGG + Exonic
1107188075 13:37547277-37547299 AAGCCTGAAGGCTATGGAGGCGG + Intergenic
1107663102 13:42659766-42659788 TAGCTTGAAGACTTTGTAGGAGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108182273 13:47852902-47852924 CGGCCTGAAGGCAATGAGGGTGG + Intergenic
1110334539 13:74311958-74311980 CAGGCTGGAGACTGAGAAGGAGG - Intergenic
1110385041 13:74900684-74900706 CATGCTGAAGACAATGGAGGAGG + Intergenic
1114129381 14:19772149-19772171 CAGCCTGAAGGAGATGAAGCAGG + Intronic
1116111009 14:40581459-40581481 CAGCATGAAGAGTGTGAAGCTGG + Intergenic
1117735045 14:58760371-58760393 CAGCCTGAATAGAATGGAGGAGG - Intergenic
1123670791 15:22654954-22654976 GAGCCTGTAGTCTAGGAAGGGGG + Intergenic
1124526763 15:30461382-30461404 GAGCCTGTAGTCTAGGAAGGGGG + Intergenic
1124771890 15:32546301-32546323 GAGCCTGTAGTCTAGGAAGGGGG - Intergenic
1127135009 15:55910957-55910979 CATGCTGAAGACAAAGAAGGGGG - Intronic
1128681730 15:69657394-69657416 CAGCCTGAAAAGTAGCAAGGAGG - Intergenic
1130901878 15:88213362-88213384 CAGCCTGAATAAAATAAAGGCGG + Intronic
1133139132 16:3731553-3731575 CAGCCTGCAGAATAGGCAGGTGG + Intronic
1133158806 16:3895388-3895410 CAACCTGAAGACTCTGGAGGAGG - Intergenic
1136677415 16:31923929-31923951 CAGCCAGAAGATAAGGAAGGGGG + Intergenic
1137634601 16:49974925-49974947 CAACATGAAGAGTATGAGGGAGG + Intergenic
1139406268 16:66720558-66720580 CATCCTCATGAGTATGAAGGTGG - Intergenic
1140720750 16:77769646-77769668 AAGCCAGAAAACTATGAAGTTGG + Intergenic
1142817873 17:2441507-2441529 CAGCCTGGCGCCTCTGAAGGAGG - Exonic
1144366232 17:14547516-14547538 ATGCCTGAAGAATATGAATGTGG + Intergenic
1145009162 17:19357631-19357653 CAGCCTGTAGCAGATGAAGGGGG + Intronic
1148249811 17:46066722-46066744 CAGGCTGAAGACTATACAAGGGG + Exonic
1149595916 17:57864631-57864653 CAGCCTGCAGTGGATGAAGGAGG + Intronic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1152102392 17:78309732-78309754 CTGCCTGCTGACTTTGAAGGTGG + Intergenic
1152455778 17:80415314-80415336 CAGCCTGAAGACTATGAGCTCGG - Intronic
1153048474 18:878757-878779 CAGGCTGCAGACGATGAGGGAGG - Intergenic
1156005108 18:32430910-32430932 TGGCCAGAAGACTAGGAAGGGGG + Intronic
1157108157 18:44794096-44794118 CAGCCTGCAGAGTATGAACAGGG + Intronic
1160820568 19:1055904-1055926 CAGCCTGAAGACTAAGAAGTGGG + Exonic
1161932528 19:7350227-7350249 CACCCTGAGGTCTAGGAAGGTGG + Intronic
1166742549 19:45123111-45123133 CAGCATCAAGGCTATGATGGAGG - Intronic
1167135533 19:47613180-47613202 CACCCAGAGGCCTATGAAGGGGG + Intronic
1167218587 19:48182475-48182497 CAGCTTGACGATGATGAAGGCGG - Exonic
1167323925 19:48812655-48812677 CTGCCTGTAGAATAGGAAGGTGG - Intergenic
925744766 2:7034482-7034504 AAGCCTGAAAACTAGGCAGGAGG - Intronic
926221596 2:10939461-10939483 CAGGAGGAAGACAATGAAGGAGG + Intergenic
927039716 2:19216165-19216187 AAGACTGAAGACTATGCAGGTGG + Intergenic
927409958 2:22813877-22813899 AAGCCTGAAGAGAATGAAAGCGG - Intergenic
928215479 2:29357733-29357755 CAGCCTGCAGATTCTGCAGGGGG - Intronic
932200173 2:69819722-69819744 CAGCCTGCAGAGTACGATGGAGG - Intronic
932705846 2:74024463-74024485 CAGCCTGGAGACCATCCAGGCGG + Intronic
934769534 2:96899067-96899089 CAGCCTGAAGACCTGGGAGGAGG + Intronic
934810051 2:97270014-97270036 CAGCCTGAGGACACTGGAGGAGG - Intergenic
934827641 2:97437925-97437947 CAGCCTGAGGACACTGGAGGAGG + Intergenic
935280355 2:101512033-101512055 CAGCCTCAAGATTATGAATTTGG - Intergenic
935368107 2:102315967-102315989 CAGCCTGAAGACAAAGAAAATGG - Intronic
936528923 2:113261531-113261553 CGGCTTACAGACTATGAAGGTGG + Intronic
937592158 2:123627850-123627872 CAGCCTGAAGTTCATGAAAGTGG + Intergenic
939292632 2:140215624-140215646 CAGTCTGAAGACAATGAATTGGG - Intergenic
941065882 2:160902227-160902249 CAGCTTGAAGATAATGAATGTGG - Intergenic
941197194 2:162467595-162467617 CAGCCTGTAAACTGTGAAGCAGG + Intronic
941759499 2:169225813-169225835 GAGCAAGAAGACTATAAAGGAGG - Intronic
945238054 2:207651126-207651148 AAGCCTGAAGAGTAAGAAAGGGG - Intergenic
946197460 2:218043737-218043759 CAGCCCCCAGACTTTGAAGGTGG + Intronic
947393338 2:229662608-229662630 TAGCCTGAAGGCCATGAGGGAGG - Intronic
948525186 2:238567049-238567071 CAGCAGGAAGACTACGAGGGGGG - Intergenic
1169874900 20:10286398-10286420 CAGCCTTCAGACTATGAAGCAGG + Intronic
1173247274 20:41345324-41345346 GAGCCTCATAACTATGAAGGAGG - Intronic
1175198222 20:57260913-57260935 CAGCCTGAATATTTTGAATGGGG - Intronic
1177868934 21:26546951-26546973 CAGCATCTAGACAATGAAGGCGG + Intronic
950895031 3:16440825-16440847 CAGCCTGCAGAGTATGGATGGGG + Intronic
951851205 3:27142186-27142208 TAGTCTGAAAACTGTGAAGGTGG - Intronic
954241286 3:49295767-49295789 CTGACTGAAGTTTATGAAGGAGG + Intronic
956351764 3:68345121-68345143 CAGGATGTAGACTGTGAAGGTGG - Intronic
957281860 3:78161258-78161280 CAGGCTGAAGATTTTGGAGGAGG - Intergenic
961829476 3:129616082-129616104 CAGGCTGATGGCTCTGAAGGGGG + Intergenic
963726863 3:148932656-148932678 CAGCCTGGATGCAATGAAGGTGG - Intergenic
965028871 3:163337096-163337118 CAGCCTGAAGACCATAAAAATGG + Intergenic
965344938 3:167536932-167536954 CAGCCTGAAGAATGGAAAGGAGG - Exonic
966486440 3:180476309-180476331 TCACCTGAAGATTATGAAGGTGG + Intergenic
966596216 3:181726516-181726538 CTGCCTGAAGAGGATGAGGGTGG - Intergenic
966826271 3:183967514-183967536 CAGGCAGAAGGCTGTGAAGGGGG + Intronic
968951758 4:3698891-3698913 CATCCTGAAGTCTGTGAGGGAGG + Intergenic
973745641 4:53960757-53960779 AAGCCTGAAGAAAATGCAGGAGG + Intronic
974874015 4:67680666-67680688 AAGCCTAAATACTATGAAGCAGG - Intronic
975799842 4:78048971-78048993 CAGCCAGAAAACGATGACGGTGG - Intergenic
976602226 4:86948928-86948950 CATCCTGAAAGCTGTGAAGGAGG + Intronic
977338341 4:95726281-95726303 CAGCTTGAAGTATGTGAAGGAGG + Intergenic
981241378 4:142480432-142480454 CAGCCAGGAGACTAGGAATGAGG + Intronic
981422300 4:144565065-144565087 CAACCTGAAAACTGAGAAGGAGG - Intergenic
982344684 4:154344580-154344602 AAGCCAGAAGAATAAGAAGGGGG + Intronic
993436496 5:87901959-87901981 CTGCCTGTAGACTCTGCAGGAGG + Intergenic
995166685 5:109051819-109051841 CAGCATGAAGATGATGAAGATGG + Intronic
995952865 5:117737997-117738019 CAACAAGAAGACTATGAAAGAGG + Intergenic
997558636 5:134823819-134823841 CAGGCTGAAGACAATGATAGAGG + Intronic
999861509 5:155652275-155652297 CAGCCTGATGGCAATGAATGGGG - Intergenic
1000987343 5:167875303-167875325 AAGTGTGAAGACTCTGAAGGTGG + Intronic
1001444177 5:171770433-171770455 CAGCCTGAGGTCTACGGAGGGGG - Intergenic
1003103228 6:3193430-3193452 CAGCTGGGAGAATATGAAGGGGG + Intergenic
1003466502 6:6384674-6384696 AACCCTGAGGACTATGAAGAAGG + Intergenic
1005491441 6:26351027-26351049 CATCTTGCTGACTATGAAGGTGG - Intergenic
1005677447 6:28169518-28169540 TATTCTGAAGACTTTGAAGGAGG + Intergenic
1005794065 6:29338794-29338816 CAAACAAAAGACTATGAAGGTGG + Intergenic
1007332716 6:41126166-41126188 TAGCATCATGACTATGAAGGTGG + Intergenic
1007687006 6:43672947-43672969 CAGGATGATGACTGTGAAGGAGG + Intronic
1008484957 6:52025726-52025748 CAGCCTCCAGACTGTGAAGAGGG + Exonic
1008494378 6:52117751-52117773 CAGCCTGTAGGAAATGAAGGGGG + Intergenic
1009953350 6:70421858-70421880 CAGCCAGCAGACTGTGCAGGAGG + Intronic
1014438548 6:121447467-121447489 CAGCATGAAGATGATGAAGATGG - Exonic
1015504573 6:133969405-133969427 CAGTCTGAAGACTGTTAAGCAGG - Intronic
1015878796 6:137850240-137850262 CAGCCTGGAGACTAAGAACAAGG + Intergenic
1018069870 6:160154851-160154873 CAGCCTGAAGACTATGAAGGGGG - Exonic
1020008015 7:4792458-4792480 CAGCCTCAGGACTATGGAGGGGG + Intronic
1020329621 7:7004285-7004307 CAGTTGGAAGACAATGAAGGTGG - Intergenic
1022759841 7:33336017-33336039 CTGGCTGAAGACCAGGAAGGAGG - Intronic
1026309070 7:69168015-69168037 CAGCCTGAAGGCTAAGATGTAGG + Intergenic
1027522684 7:79229950-79229972 CACTCTGAAGACTGTGAGGGTGG - Intronic
1033407805 7:141087742-141087764 TATTCTGAAGATTATGAAGGTGG + Intronic
1038275865 8:26120183-26120205 CAGCTTGGAGACTGTGAAGCTGG - Intergenic
1041986041 8:63923372-63923394 TAGGCTGAGGACTATGATGGTGG + Intergenic
1045872255 8:106940101-106940123 CAGCCTGCACACTATGTAGAAGG - Intergenic
1046066187 8:109199506-109199528 CTACTTGAAGACTTTGAAGGTGG + Intergenic
1047695881 8:127403271-127403293 CAGCCTGAAGTTTATGTAGGTGG + Intergenic
1049813661 8:144587966-144587988 CAGCCTCCAGTCTCTGAAGGTGG + Intronic
1052346045 9:27410666-27410688 CAGCCTGAAGACCACCAAGCAGG - Intronic
1055681692 9:78722210-78722232 CAGTCTGCTGACAATGAAGGTGG + Intergenic
1055719365 9:79154439-79154461 CAGGCTGTAGACTGTGGAGGAGG - Intergenic
1057492515 9:95532287-95532309 CAGCCTCTAGACACTGAAGGAGG + Intergenic
1058948901 9:109884833-109884855 TAGCTTGAAGACACTGAAGGAGG + Intronic
1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG + Intergenic
1185483930 X:468183-468205 CAGGCTGGAGGCTCTGAAGGAGG - Intergenic
1186256692 X:7729459-7729481 CTGCCTGAAGACTGAAAAGGAGG - Intergenic
1188197260 X:27251716-27251738 CAGCCAAAAGACTAGGAAAGGGG - Intergenic
1191847865 X:65562124-65562146 CCTCCTGAAGACTAGGAAGATGG - Intergenic
1192243907 X:69357867-69357889 CATCCTGAAGAGGAGGAAGGAGG - Intergenic
1195310057 X:103624147-103624169 CAGCCTGAGGCCTGGGAAGGAGG - Intronic
1196088119 X:111708279-111708301 CAGCCAGAAGTCTTTGAATGAGG + Exonic
1196927499 X:120647903-120647925 CAGAGTGAATACAATGAAGGAGG - Intergenic
1198640417 X:138749934-138749956 CAGCATGAAGACTAGTATGGTGG + Intronic