ID: 1018070610

View in Genome Browser
Species Human (GRCh38)
Location 6:160161399-160161421
Sequence CACCCATCACTTGCTGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018070610_1018070625 25 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070625 6:160161447-160161469 CAGGATGGGGTGGTAGCCGGGGG No data
1018070610_1018070616 -4 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070616 6:160161418-160161440 GGTGTGGGGGGCTGCAGATCAGG No data
1018070610_1018070620 12 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070620 6:160161434-160161456 GATCAGGAAAGAGCAGGATGGGG No data
1018070610_1018070617 6 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070617 6:160161428-160161450 GCTGCAGATCAGGAAAGAGCAGG No data
1018070610_1018070623 23 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070623 6:160161445-160161467 AGCAGGATGGGGTGGTAGCCGGG No data
1018070610_1018070619 11 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070619 6:160161433-160161455 AGATCAGGAAAGAGCAGGATGGG No data
1018070610_1018070626 30 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070626 6:160161452-160161474 TGGGGTGGTAGCCGGGGGTCTGG No data
1018070610_1018070624 24 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070624 6:160161446-160161468 GCAGGATGGGGTGGTAGCCGGGG No data
1018070610_1018070622 22 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070622 6:160161444-160161466 GAGCAGGATGGGGTGGTAGCCGG No data
1018070610_1018070621 15 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070621 6:160161437-160161459 CAGGAAAGAGCAGGATGGGGTGG No data
1018070610_1018070618 10 Left 1018070610 6:160161399-160161421 CCTTGGTCAGCAAGTGATGGGTG No data
Right 1018070618 6:160161432-160161454 CAGATCAGGAAAGAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018070610 Original CRISPR CACCCATCACTTGCTGACCA AGG (reversed) Intergenic
No off target data available for this crispr