ID: 1018071322

View in Genome Browser
Species Human (GRCh38)
Location 6:160167046-160167068
Sequence TGAGGTCCACACTGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018071314_1018071322 12 Left 1018071314 6:160167011-160167033 CCTGCCATCTCATTCTGTGGACA No data
Right 1018071322 6:160167046-160167068 TGAGGTCCACACTGGCTGCTGGG No data
1018071311_1018071322 20 Left 1018071311 6:160167003-160167025 CCCAGGTGCCTGCCATCTCATTC No data
Right 1018071322 6:160167046-160167068 TGAGGTCCACACTGGCTGCTGGG No data
1018071315_1018071322 8 Left 1018071315 6:160167015-160167037 CCATCTCATTCTGTGGACAGAGC No data
Right 1018071322 6:160167046-160167068 TGAGGTCCACACTGGCTGCTGGG No data
1018071312_1018071322 19 Left 1018071312 6:160167004-160167026 CCAGGTGCCTGCCATCTCATTCT No data
Right 1018071322 6:160167046-160167068 TGAGGTCCACACTGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018071322 Original CRISPR TGAGGTCCACACTGGCTGCT GGG Intergenic
No off target data available for this crispr