ID: 1018071746

View in Genome Browser
Species Human (GRCh38)
Location 6:160170831-160170853
Sequence GAGATGACTGTCCGGTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018071743_1018071746 10 Left 1018071743 6:160170798-160170820 CCATCTATTTGTTGGACGTGCAC No data
Right 1018071746 6:160170831-160170853 GAGATGACTGTCCGGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018071746 Original CRISPR GAGATGACTGTCCGGTTTAT GGG Intergenic
No off target data available for this crispr