ID: 1018072109

View in Genome Browser
Species Human (GRCh38)
Location 6:160173981-160174003
Sequence CTCCCTGCTCAGGGAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 1, 2: 10, 3: 47, 4: 534}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018072098_1018072109 2 Left 1018072098 6:160173956-160173978 CCACAGCCCCAGGCTCCCTCTCA 0: 1
1: 1
2: 12
3: 144
4: 1220
Right 1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG 0: 1
1: 1
2: 10
3: 47
4: 534
1018072097_1018072109 3 Left 1018072097 6:160173955-160173977 CCCACAGCCCCAGGCTCCCTCTC 0: 1
1: 1
2: 5
3: 92
4: 742
Right 1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG 0: 1
1: 1
2: 10
3: 47
4: 534
1018072100_1018072109 -5 Left 1018072100 6:160173963-160173985 CCCAGGCTCCCTCTCAACCTCCC 0: 1
1: 0
2: 6
3: 68
4: 620
Right 1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG 0: 1
1: 1
2: 10
3: 47
4: 534
1018072099_1018072109 -4 Left 1018072099 6:160173962-160173984 CCCCAGGCTCCCTCTCAACCTCC 0: 1
1: 0
2: 10
3: 65
4: 750
Right 1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG 0: 1
1: 1
2: 10
3: 47
4: 534
1018072101_1018072109 -6 Left 1018072101 6:160173964-160173986 CCAGGCTCCCTCTCAACCTCCCT 0: 1
1: 0
2: 10
3: 115
4: 1646
Right 1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG 0: 1
1: 1
2: 10
3: 47
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018072109 Original CRISPR CTCCCTGCTCAGGGAGGGTG AGG Intronic
900229930 1:1551575-1551597 CCCACTGGTCAGGGAGGGGGAGG + Intronic
900363144 1:2299579-2299601 CTCCTTGCTCTGGGGGGTTGAGG + Intronic
900546647 1:3233189-3233211 CCCCCTGCCCAGGGTGGGGGTGG + Intronic
900551809 1:3260164-3260186 CTCCCTGCTAGGCCAGGGTGTGG - Intronic
900703000 1:4059455-4059477 GTCCATGCTCAGGGAGCCTGGGG + Intergenic
901464578 1:9413128-9413150 CTCCCTGCTGGGTCAGGGTGAGG - Intergenic
901632475 1:10654682-10654704 TTCCCTGCTCAGGGAAGCTTTGG + Intronic
901881978 1:12199370-12199392 GACCCAGCCCAGGGAGGGTGTGG + Intronic
901910094 1:12450005-12450027 ATCCCTGCTACGGGAGGCTGAGG + Intronic
902205865 1:14867728-14867750 CTCCATGCCCAGGGTGGGGGGGG - Intronic
902244885 1:15114303-15114325 CTCCCTGCTCAGGGAGGTTGAGG - Intronic
902530726 1:17089166-17089188 CTCCCTCCCAAGGGAGGATGAGG - Intronic
902741188 1:18439498-18439520 CTCCCTCCTCAGGGTGGGGTGGG + Intergenic
903138064 1:21322259-21322281 CTCCGGGCTCAGGTGGGGTGTGG - Intronic
903212204 1:21824536-21824558 CCTCCTGCTCTGGCAGGGTGTGG - Exonic
903557907 1:24206600-24206622 CTTCCTGCTCAGGGAAGGTAGGG - Intergenic
904127533 1:28252134-28252156 CCCGCTACTCAGGGAGGCTGAGG - Intergenic
904447893 1:30589264-30589286 CTCCCTGCTCGGGGCGGCAGAGG - Intergenic
904604651 1:31691896-31691918 CCCCTTGCTCAGACAGGGTGGGG - Intronic
904622426 1:31783285-31783307 GTCCCTGGTCAGGAGGGGTGGGG + Intergenic
904687182 1:32269017-32269039 CCACCTGCTTAGGGAGGCTGAGG + Intronic
905865179 1:41372534-41372556 CTGCCTGCAGAGGGAGGGAGGGG + Intronic
905995281 1:42376004-42376026 CTTACAGCGCAGGGAGGGTGGGG + Intergenic
906729484 1:48069044-48069066 CTTCCTGCTCAGGGAAACTGAGG + Intergenic
907022122 1:51078156-51078178 CTCAGTGCTCTGGGAGGCTGAGG - Intergenic
907401718 1:54228700-54228722 CTGGCTGCCCAGGCAGGGTGGGG + Intronic
908011521 1:59783006-59783028 CTCACTGCTTTGGGAGGCTGAGG - Intergenic
912103012 1:106234558-106234580 GTCCCAGAACAGGGAGGGTGGGG - Intergenic
913220278 1:116654537-116654559 CGCCCTGGCAAGGGAGGGTGAGG - Intronic
915064963 1:153217379-153217401 CTCCCTGCTGAGGTCTGGTGAGG + Intergenic
915310825 1:155005096-155005118 GTGCCTGCCCAGGGAGGGTGCGG + Intronic
915596374 1:156898556-156898578 CTCCCTGTGTAGGGAGGGAGGGG + Intronic
916202822 1:162287955-162287977 CTCCGTGTGCAGGGATGGTGGGG + Intronic
916220630 1:162441251-162441273 CTTGCTGCTCAAGGAAGGTGGGG - Intergenic
916939028 1:169661322-169661344 CTCACTGCCCAGGGCTGGTGGGG - Intergenic
916940065 1:169668160-169668182 CTCACTGCCCAGGGCCGGTGGGG - Intronic
917386048 1:174475653-174475675 ATCCCAGCTCTGGGAGGCTGAGG + Intronic
917438575 1:175045470-175045492 CTCCCCGGTTTGGGAGGGTGAGG + Intergenic
918082964 1:181221617-181221639 CATCCTGCTCTGGGAGGGTAGGG - Intergenic
919297771 1:195723125-195723147 CTCACTGCCCAGGGCCGGTGGGG + Intergenic
919315408 1:195966301-195966323 CTCCTGGCATAGGGAGGGTGAGG + Intergenic
919839374 1:201597923-201597945 CTCCCTGGCCAAGGTGGGTGGGG - Intergenic
920051838 1:203169017-203169039 CGCCTTGCTCAGAGAGGGCGCGG + Exonic
920093683 1:203472024-203472046 CTCCCAGTCCAGGGTGGGTGGGG - Intergenic
920371936 1:205484639-205484661 GAGCCTCCTCAGGGAGGGTGCGG + Intergenic
920434024 1:205936643-205936665 CTCCCAGCTCTGGGAGGTAGAGG - Intronic
922753323 1:228081347-228081369 CTCCCTGCTCAGCCAGAGCGGGG - Intergenic
922979068 1:229809641-229809663 CTCCCTGCACTTGGTGGGTGGGG + Intergenic
923341090 1:233007788-233007810 CCAACTGCTCAGGGAGGCTGAGG - Intronic
923460480 1:234205824-234205846 CTATCTGCTCAGGCAGGGGGAGG - Intronic
923499413 1:234551850-234551872 CCAGCTGCTCAGGGAGGCTGAGG - Intergenic
923506914 1:234611940-234611962 CTCCCAGCTTGGAGAGGGTGAGG - Intergenic
924179115 1:241423966-241423988 CACCCTGCTGCAGGAGGGTGGGG - Intergenic
924457596 1:244230965-244230987 TTCCCTCCTCAGGGAGGAAGAGG - Intergenic
1062982570 10:1737383-1737405 CTCCCTGGTCAGGGAGGGCGGGG + Exonic
1063100322 10:2944738-2944760 CTTCCTTCTAAGGGAGGGTGGGG + Intergenic
1063439312 10:6059648-6059670 TGCCCTGGACAGGGAGGGTGGGG - Intronic
1063549011 10:7010899-7010921 CTTCTTGCTCAGGGAAGGTCGGG + Intergenic
1063713955 10:8508991-8509013 CTCTCTTCTCAGGGAGTATGAGG - Intergenic
1063970588 10:11378934-11378956 TTCCCTGCACTGGGAGAGTGGGG - Intergenic
1064589208 10:16871290-16871312 ATCCCAGCACAGGGAGGCTGAGG - Intronic
1064601440 10:16997669-16997691 CTTTCAGGTCAGGGAGGGTGGGG + Intronic
1065663621 10:28034516-28034538 CTCCCTGCTCAGGGACCTAGTGG - Intergenic
1066588135 10:36960795-36960817 CTCTCTGCTCCTGGAAGGTGGGG + Intergenic
1067093786 10:43285365-43285387 CTTCCTGCTAATGGAGGGGGAGG + Intergenic
1067290671 10:44937483-44937505 CTCTCTGCTGAGGTAGGGAGGGG - Intergenic
1068377122 10:56195363-56195385 CTCCCTGGTCAGGGAGAGGAAGG + Intergenic
1069774312 10:70917965-70917987 CTCCCTGGTTTGGGAGGGAGTGG - Intergenic
1070472787 10:76800719-76800741 CTGGCTGCCCAGGGAGGCTGAGG - Intergenic
1070607887 10:77912084-77912106 CTAGCTACTCAGGGAGGCTGAGG + Intronic
1070698037 10:78577544-78577566 CTCCCTGGGCACTGAGGGTGGGG + Intergenic
1070729165 10:78813469-78813491 ATCCCTCCTCAGTGAGAGTGGGG - Intergenic
1071345120 10:84685067-84685089 CTCCCTGCTCAGGGGGGAAGTGG - Intergenic
1071894565 10:90051524-90051546 ATCCCTGCCCAGGAAGGGTAGGG + Intergenic
1071894605 10:90051739-90051761 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1072723348 10:97794898-97794920 CCAGCTACTCAGGGAGGGTGAGG - Intergenic
1073063477 10:100745502-100745524 CTCCCGGCGCGGGGAGGGGGAGG + Intronic
1073374485 10:103021235-103021257 CTCCTTCGTCAGGGAGGCTGTGG - Intronic
1073521300 10:104132497-104132519 CCAGCTGCTCCGGGAGGGTGAGG + Intronic
1073572105 10:104589365-104589387 CTCCTTCCTCAGTGAGGGGGAGG + Intergenic
1074853134 10:117454607-117454629 CTCCCTGCTCAGGGAGGCAGGGG + Intergenic
1075659302 10:124182324-124182346 CTCCTTTCTCAGGGACTGTGTGG - Intergenic
1075789179 10:125071212-125071234 CTCCCTGCTCTGGGAAGGGAAGG + Intronic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1076762307 10:132611709-132611731 GGCCCTGTCCAGGGAGGGTGAGG + Intronic
1076816405 10:132917126-132917148 CTCTCTGCTCAGGGAGCCGGAGG - Intronic
1077032552 11:476055-476077 CTCCCTGCTCAGGGCCTCTGTGG - Intronic
1077337304 11:2011132-2011154 CTCCGTGCTCAGGGAGCTTCTGG - Intergenic
1077368638 11:2171493-2171515 GTCCCTGTTGGGGGAGGGTGAGG - Intronic
1077583798 11:3435199-3435221 CTCACTGCCCAGGGACGGCGGGG + Intergenic
1077665388 11:4103736-4103758 ATCCCAGCTGAGGGAGGCTGAGG - Intronic
1077689654 11:4329873-4329895 CTCCCCACTCAGGGTGGCTGTGG + Intergenic
1077764583 11:5144520-5144542 CTCACTGCCCAGGGCCGGTGGGG - Intergenic
1078188692 11:9074091-9074113 CTCCCTGCTCTGGGTGGGTAGGG - Intronic
1078241064 11:9531163-9531185 ATCCCAGTTCAGGGAGGGTTGGG + Intergenic
1078375234 11:10787775-10787797 CTCACTGCTTTGGGAGGCTGAGG - Intergenic
1078514165 11:12008714-12008736 CTCCCGTCTCCGGGCGGGTGCGG - Intronic
1078584116 11:12565906-12565928 CTGACTGATCAGGGTGGGTGGGG + Intergenic
1078798387 11:14617080-14617102 CTGCCTGCTGAGAGTGGGTGTGG + Intronic
1079190985 11:18276348-18276370 CTCACTGCCCAGGGCCGGTGGGG + Intergenic
1079258407 11:18852942-18852964 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1080805538 11:35649712-35649734 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1080907923 11:36565358-36565380 CAACCTGCTCAGGGGGGTTGGGG + Intronic
1081735429 11:45400189-45400211 CTCACTCCTCAAGGAGGATGAGG + Intergenic
1081773132 11:45661933-45661955 CTGCCTGCTGGGGCAGGGTGAGG - Intronic
1081866160 11:46361803-46361825 CTCCTTGCCTAGGGATGGTGGGG - Intronic
1081892711 11:46557553-46557575 ATCCCTGCCCTGGGAGGTTGAGG + Intronic
1082702711 11:56453080-56453102 CTCCATTCTCAAGGAGGCTGTGG - Intergenic
1082828322 11:57597650-57597672 CCCCAGGGTCAGGGAGGGTGGGG - Exonic
1083587236 11:63869219-63869241 CTCCCTGCCCAGGGTGGGGGTGG - Intronic
1083663719 11:64263818-64263840 CTGCCTGGCCAGGGAGTGTGAGG + Intronic
1083693463 11:64426293-64426315 ATCCCAGCTGAGGGAGGCTGAGG - Intergenic
1083784014 11:64933678-64933700 CTCCCTGGGGAGAGAGGGTGAGG - Exonic
1084640606 11:70423704-70423726 CTAGCTGCAGAGGGAGGGTGGGG + Intronic
1084705713 11:70814979-70815001 GTCCCTGCTCTGGGAGTGTGTGG - Intronic
1084857151 11:71996598-71996620 CTCCCTGCCTAAGCAGGGTGGGG + Exonic
1084974213 11:72787719-72787741 CTCTGTGCTCAGGCTGGGTGGGG + Intronic
1085021555 11:73213375-73213397 CCTCCTTCTCAGTGAGGGTGAGG - Intergenic
1085415231 11:76315276-76315298 CTCCCTGCCCAGGGAGGTGTGGG - Intergenic
1085636520 11:78163466-78163488 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1085637095 11:78167336-78167358 CTCTCTGCTCAGGAATGGTGGGG + Intergenic
1085689369 11:78652934-78652956 CTCCCTCCTCTGGGAGGGTTGGG + Exonic
1087356230 11:97097931-97097953 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1088474721 11:110223235-110223257 CCAGCTGCTCAGGGAGGCTGAGG + Intronic
1088779913 11:113123949-113123971 TTGCCTGCTCAGGGTGGTTGGGG + Intronic
1089287589 11:117417569-117417591 CTCCCGGCTCGGGCAGGATGGGG + Intergenic
1089443335 11:118533322-118533344 CTCCTTGCCCAGGGTGGCTGGGG - Intronic
1089697535 11:120225360-120225382 CACCCTGATCAGGGTGGGTCAGG - Intronic
1090616327 11:128518828-128518850 CCCTCTGCTGAGGGCGGGTGGGG + Intronic
1090868828 11:130725267-130725289 TTTCCTGCCCAGGCAGGGTGGGG - Intergenic
1202820288 11_KI270721v1_random:66314-66336 CTCCGTGCTCAGGGAGCTTCTGG - Intergenic
1092836633 12:12495659-12495681 CTCTCTGTTCAGTGAGGCTGAGG + Intronic
1093863857 12:24200991-24201013 CTCCCTGACCAGGGAGGTGGAGG - Intergenic
1095867023 12:46983490-46983512 ATCCCTGCACAGGAAGGGTGGGG - Intergenic
1096148100 12:49293189-49293211 CTCCCTGCTCCTGGAGGGTGGGG + Intergenic
1096189877 12:49609575-49609597 ATCTCTACACAGGGAGGGTGGGG - Intronic
1096238088 12:49943301-49943323 CTCCCTGCTCAGAGGAGCTGCGG - Intergenic
1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG + Intergenic
1098102693 12:67035304-67035326 CACCCTGCTGAGGGGGGCTGAGG - Intergenic
1098403957 12:70104178-70104200 CTCCCTGCACAGGCAGGGGCAGG + Intergenic
1102173984 12:110862602-110862624 CTCCCTGTTAAGGGAAGCTGTGG - Intronic
1102244209 12:111344739-111344761 CTCCCTGCTCAGGTCCTGTGGGG - Intronic
1103319545 12:120083551-120083573 CACCCTGTTCAAGGAGTGTGAGG + Intronic
1103341846 12:120224986-120225008 CCCCCTGCTCACTGAGGGGGTGG - Intronic
1103989017 12:124785967-124785989 ATCCCTGCTCAGGGGGATTGAGG - Intronic
1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG + Intronic
1104758708 12:131284353-131284375 CTCCCTTCCCAGGGAGGGGAGGG + Intergenic
1104821892 12:131682172-131682194 CTCCCTTCCCAGGGAGGGGAGGG - Intergenic
1105364952 13:19756120-19756142 CCAGCTACTCAGGGAGGGTGAGG + Intronic
1109620611 13:64900314-64900336 TTCTCTGCACAGGAAGGGTGGGG - Intergenic
1109646415 13:65264274-65264296 ATCTCTGCACAGGAAGGGTGAGG - Intergenic
1110305105 13:73977294-73977316 ATCCCAGCTCTGGGAGGCTGAGG - Intronic
1110907231 13:80907034-80907056 TTCCCTGCTCAAGGACAGTGTGG - Intergenic
1112179035 13:97058452-97058474 CTCCTTGCTCCTGGAGGGAGAGG - Intergenic
1112996819 13:105584642-105584664 ACCCCTGCTTAGGGAGGCTGAGG + Intergenic
1113225136 13:108151520-108151542 CTCCATGCTTTGGGAGGCTGAGG + Intergenic
1113593028 13:111513981-111514003 CGCCCTGCCTAGGGAGGATGTGG - Intergenic
1113617785 13:111693336-111693358 GTCCCCGCTAAGGGAAGGTGAGG - Intergenic
1115472837 14:33785991-33786013 CTCCCTGCTGTGGGGTGGTGGGG - Intronic
1115561742 14:34588881-34588903 CTCCCTCCTTTGGGAGGCTGAGG + Intronic
1116222908 14:42111613-42111635 GTCTCTGCACAGGAAGGGTGGGG + Intergenic
1116657027 14:47665867-47665889 CGCGCTCCTCAGGGAGGCTGAGG - Intronic
1117449807 14:55839614-55839636 CTCACTGCCCAGGGCTGGTGGGG - Intergenic
1117551650 14:56843112-56843134 GTCCCAGCTGAGGGAGGCTGAGG - Intergenic
1118500933 14:66362022-66362044 CTCCCTGCTCTGGCAGCCTGTGG + Intergenic
1118834758 14:69469659-69469681 CTCCGTGCTTTGGGAGGGTGAGG - Intergenic
1118990433 14:70792614-70792636 CACCCTGGTCAGGGATGATGTGG - Intronic
1119313306 14:73669231-73669253 CTAGCTACTCAGGGAGGCTGAGG - Intronic
1119650749 14:76381194-76381216 GTCCCTGCGCGGGGAGGTTGTGG + Intronic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120019358 14:79510869-79510891 CTCCCAGCTCAAGCAGGGAGAGG + Intronic
1120037554 14:79715348-79715370 CTCTCTGCTCAGGGAGTTTTGGG - Intronic
1120279410 14:82420112-82420134 ATCTCTGCTCAGGAAGAGTGGGG + Intergenic
1121006703 14:90495418-90495440 GTCCCTGCTCAGGGTGAGTGAGG - Intergenic
1121104105 14:91269665-91269687 CTCCCTTTGTAGGGAGGGTGGGG + Intergenic
1121329434 14:93040698-93040720 CTTCCTGCTCAGGGAGTGCTGGG - Intronic
1121548713 14:94781893-94781915 GTCCCTGTGCTGGGAGGGTGGGG + Intergenic
1121609316 14:95265125-95265147 CCAGCTGCTCTGGGAGGGTGAGG + Intronic
1121990480 14:98552175-98552197 CTCCCTGATAAGGGAGGGCAGGG - Intergenic
1122037034 14:98956431-98956453 CTCCCTGCTCCGGGTGCATGTGG - Intergenic
1122181427 14:99957719-99957741 CTCAGTGCTTAGGGAGGCTGAGG - Intergenic
1122308283 14:100779170-100779192 CCCCCTGCCATGGGAGGGTGTGG + Intergenic
1122785822 14:104162862-104162884 CTGCCTGTCCAGGTAGGGTGGGG + Intronic
1122796275 14:104207693-104207715 CTCCCTGCGGAGGTAGGGGGAGG - Intergenic
1122848381 14:104513266-104513288 CTCCCTGCCCTGGCGGGGTGTGG - Intronic
1122881109 14:104690783-104690805 CGCCCTGCACTGGGAAGGTGGGG + Intronic
1123109003 14:105856585-105856607 CTCCCTGCTCAGAATGGCTGAGG + Intergenic
1123986587 15:25651704-25651726 ATCCCAGCTGAGGGAGGCTGAGG - Intergenic
1125618028 15:41033447-41033469 CTCTCTACTCAAGGAGGCTGAGG - Intronic
1126031572 15:44504616-44504638 ATCCCTGCACTGGGAGGCTGAGG + Intronic
1127963996 15:63910376-63910398 CGCCCTGCTCAGGGAGCGACTGG - Intronic
1128730812 15:70019618-70019640 CTTCCTGGACAGAGAGGGTGAGG + Intergenic
1128986997 15:72229648-72229670 CTTCCTGCTGTGGGAGGGAGGGG - Intronic
1129014029 15:72450104-72450126 ATCCCTGCTACGGGAGGCTGAGG - Intergenic
1129078204 15:73015647-73015669 CTCCCTGTTCAGGCCAGGTGTGG - Intergenic
1129098156 15:73231617-73231639 CTAGCTGCTCAGGGAGGCTGAGG + Intronic
1129235499 15:74221581-74221603 CTTCCTGCTCTGTGTGGGTGGGG + Intergenic
1129538536 15:76333404-76333426 CTCCCTTCTCAGGTATGGAGGGG - Intergenic
1129616286 15:77100985-77101007 CCCCTTGCTGAGGGAGGGAGGGG + Exonic
1129699415 15:77759025-77759047 CTCCTTACTCAGGGAGGGTGGGG - Intronic
1130384684 15:83400847-83400869 CTGCCTCCTCAGGGAAGATGAGG - Intergenic
1130526245 15:84709279-84709301 CCAGCTGCTCAGGGAGGCTGAGG - Intronic
1130823143 15:87516251-87516273 CTTCCTTCTCAGGGAGGAAGAGG - Intergenic
1130867591 15:87945679-87945701 CTCCCTGTTCTGGGAGAATGAGG + Intronic
1131992071 15:98102310-98102332 CTGGCTACTCAGGGAGGCTGAGG - Intergenic
1132602810 16:781534-781556 CACCCCTCTCAGGGAGGGTGAGG + Intronic
1133021422 16:2968623-2968645 GTCCCTGCTCAGGGTGGACGGGG + Intronic
1133045767 16:3087518-3087540 CTCCTTCCTCAGGAAGGCTGGGG - Intergenic
1133283525 16:4680236-4680258 CTCCCTGCCCAGGGAGTTTGTGG + Intronic
1133318020 16:4895881-4895903 GAGCCAGCTCAGGGAGGGTGGGG - Intronic
1133908097 16:10039721-10039743 CTCATTGCTGAGGGAGGGAGGGG - Intronic
1134118256 16:11565639-11565661 CTCCCTGCTCCGGGTTTGTGGGG + Intronic
1134283753 16:12841830-12841852 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1134839139 16:17387400-17387422 TTCCCTGCTGAGGGAGGTGGGGG - Intronic
1135177052 16:20239686-20239708 CTCCCTGTGCAAGGATGGTGAGG + Intergenic
1135983132 16:27164153-27164175 CTTGCTACTCAGGGAGGCTGAGG - Intergenic
1136559686 16:31031829-31031851 AACCCAGCTCAGGCAGGGTGTGG - Intergenic
1136640217 16:31557739-31557761 ATCCCTGCCCAGGAAGGGAGGGG - Intergenic
1137734884 16:50716409-50716431 CTCCCTGGCCAGGGACCGTGGGG + Intronic
1139342632 16:66278425-66278447 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1139698408 16:68691942-68691964 CCCCATCCTCAGGGAGGGGGTGG - Intronic
1141664102 16:85457067-85457089 CTGCCTGCTCGGGGTGGCTGTGG + Intergenic
1141900328 16:86986862-86986884 CTCCCAGATCAGGGAGGGGAGGG + Intergenic
1142137952 16:88460171-88460193 CACCCGGCTCTGGGAGGGTCTGG + Intronic
1142523242 17:519590-519612 CCACCTGCACAGGGAGGATGGGG - Intronic
1142594611 17:1023382-1023404 CTGCCTGCACAGGGAGGCAGTGG - Intronic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1142861571 17:2765325-2765347 CTCCCGGCTCAGGTAAGATGGGG - Intergenic
1142885619 17:2910544-2910566 GTGCAGGCTCAGGGAGGGTGTGG + Intronic
1143098230 17:4489895-4489917 GTCCCAGCTCTGGGAGGCTGAGG + Intergenic
1143260636 17:5595920-5595942 CTCTCTGCTCTGGGTGGGGGAGG + Intronic
1143756737 17:9072943-9072965 CTCCCTGCTACAGGAGGGTGGGG - Intronic
1144143029 17:12368548-12368570 CCACCTACTCAGGGAGGCTGAGG - Intergenic
1144203059 17:12958652-12958674 TCCCCTGCCCAGGAAGGGTGTGG + Intronic
1145890042 17:28407828-28407850 CTCCTGGCTCAGGGGAGGTGGGG - Intergenic
1147212306 17:38878802-38878824 CTGCCTGGTGAGGGAGGCTGTGG + Intronic
1147383568 17:40069586-40069608 CTGGCTGCTGGGGGAGGGTGGGG + Intronic
1147914928 17:43880508-43880530 CTTCAGGCTCAGGAAGGGTGAGG - Intronic
1147978849 17:44262606-44262628 ATCCCAGCTGAGGGAGGGAGAGG + Intronic
1148046020 17:44745263-44745285 TTCTCTGCTCAGGGAGGCTTAGG - Intronic
1148164751 17:45475545-45475567 CGCCCTGCTCCGGGATGCTGAGG - Exonic
1148272099 17:46269414-46269436 ATCCCAGCTGAGGGAGGCTGAGG + Intergenic
1149300947 17:55304297-55304319 CTCCCGGCCCAGGGAGGAGGAGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150395970 17:64822212-64822234 CGCCCTGCTCCGGGATGCTGAGG - Intergenic
1151390231 17:73782016-73782038 TTCCCTGCCCAGGGAAGGAGGGG - Intergenic
1151784702 17:76269837-76269859 CTCCCTGCCCAGGGAAGGTGCGG + Intronic
1151908023 17:77061913-77061935 CCCCCTGCTCAGGGTGGCTCTGG + Intergenic
1152153763 17:78619277-78619299 CTCTTTGCCCAGGGAGGGAGTGG + Intergenic
1152164356 17:78692569-78692591 CTCTCTTCTCAGAGAGGGTTGGG + Intronic
1152558816 17:81067777-81067799 CTCCCTGCTCTGGCCGGCTGAGG - Intronic
1153229730 18:2924339-2924361 CCCCGTGCTCAGGGAGGGGCAGG - Intronic
1153233899 18:2967474-2967496 CTCCCCGGTCAGGGAGGGCAGGG + Intronic
1154954855 18:21243146-21243168 CGCCCTGGCCGGGGAGGGTGAGG + Intronic
1155740405 18:29281883-29281905 TTCCCTGCTCAGGGAGGCTCTGG - Intergenic
1157147697 18:45181370-45181392 CTCCCTGCTCAGGGTGGCAGAGG + Intergenic
1157482612 18:48065120-48065142 CTCGCTGGACAGGGAGGGGGCGG - Intronic
1157830147 18:50850163-50850185 ATCCCAGCTGAGGGAGGCTGAGG + Intergenic
1160010881 18:75106419-75106441 CTCCTGGCTGAGGCAGGGTGAGG + Intergenic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1160167695 18:76528777-76528799 TTTCCTGCCCAGGGCGGGTGAGG + Intergenic
1160412847 18:78686722-78686744 CACACAGCACAGGGAGGGTGTGG - Intergenic
1160945334 19:1640099-1640121 CCACCTGCGCAGGGAGGCTGAGG - Intronic
1161065920 19:2237165-2237187 CTCACTGCTCAGGGAGGCCTTGG + Intronic
1161068611 19:2249836-2249858 CACCCTGGGCAGGGAGGCTGTGG + Intronic
1161112502 19:2477980-2478002 CTCCAGTCTCAAGGAGGGTGGGG - Exonic
1161138384 19:2634064-2634086 CTCCCTCCTCACTCAGGGTGTGG - Intronic
1161212598 19:3075368-3075390 CTCCCTCCCCACTGAGGGTGTGG + Intergenic
1161283524 19:3457821-3457843 CACCCAGCACAGGGAGGGAGGGG - Intronic
1161286704 19:3472141-3472163 CTCGCTGCTGAGGGTGAGTGGGG - Intergenic
1162344711 19:10112468-10112490 CTCCCTCCTTCGGGAGGATGGGG - Intronic
1162413104 19:10518004-10518026 CCCCCGGCTCAGGGCGAGTGGGG + Intergenic
1162445472 19:10719808-10719830 CTCCCAGCTCAGCTAAGGTGGGG - Intronic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1163104382 19:15115119-15115141 TCCCCTCCTCAGGGAGGTTGTGG + Exonic
1163187626 19:15650090-15650112 CACCCTGGCTAGGGAGGGTGCGG - Exonic
1163189643 19:15667148-15667170 CACCCTGGCTAGGGAGGGTGTGG - Intergenic
1163676280 19:18656796-18656818 CTCCCAGCACAGGGCGGGAGTGG + Intronic
1164520441 19:28975122-28975144 CTGCCTGCTCAGGGAGGTCTTGG - Intergenic
1165100240 19:33434852-33434874 CTCCCAGAACAGGGAGGGTCAGG - Intronic
1165157249 19:33796219-33796241 CTCCGGGCTCGGGGAGGGGGCGG - Intronic
1165222462 19:34328064-34328086 CTATCTGCACAGGGACGGTGGGG - Exonic
1165773668 19:38392306-38392328 CTCTCTGCTGGGGGAGGGTAGGG + Intronic
1166703197 19:44893910-44893932 CTCCCTGCTCACGGTGGCCGAGG - Intronic
1167772587 19:51530507-51530529 ATCCCTCCTCAGGGATGTTGAGG - Intronic
1167966991 19:53156036-53156058 CTCCCAGCTCGGGGGGGGGGGGG + Intronic
1168126381 19:54285795-54285817 CCCCAGGCCCAGGGAGGGTGTGG + Intergenic
1168175514 19:54625069-54625091 CCCCAGGCCCAGGGAGGGTGTGG - Intronic
1168241440 19:55091102-55091124 ATCCCTGCTCAGGAGGGGAGGGG + Exonic
1168242526 19:55094613-55094635 CTCCCTGCTGGGGGCGGGGGCGG + Intronic
925503069 2:4528704-4528726 CTCCATACCCAGGGTGGGTGAGG + Intergenic
925918551 2:8624188-8624210 CTCCGTGCCCAGGGAGGGAGTGG - Intergenic
926098800 2:10100170-10100192 CACTCTGTTCAGGGAGGGAGGGG - Intergenic
927016981 2:18974523-18974545 CTCCCAGTTAAGTGAGGGTGAGG - Intergenic
927202931 2:20589733-20589755 AGCCCTGTTCAGGAAGGGTGTGG - Intronic
928377506 2:30787678-30787700 CTTGCTGCTCAGGGAAGCTGTGG - Intronic
928551850 2:32380474-32380496 ATCCCAGCTGAGGGAGGCTGAGG + Intronic
929514262 2:42592144-42592166 GTCCCAGCTAAGGGAGGCTGAGG + Intronic
930127941 2:47817855-47817877 ATCACTGATCAGGGTGGGTGTGG + Intronic
930914773 2:56673030-56673052 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
931115743 2:59164728-59164750 CTCCAGGTTCTGGGAGGGTGGGG + Intergenic
932355119 2:71061980-71062002 ATCCCTACTCAGGGGGGCTGAGG + Intergenic
932396062 2:71449017-71449039 CTCCCTGCTCAAGAGGAGTGAGG + Intergenic
932463653 2:71899122-71899144 CTGCCTGCTCAGGGGAGGTGAGG + Intergenic
933994526 2:87658211-87658233 CTCCCTGTGCAGGTAGGGTGTGG - Intergenic
934157849 2:89219791-89219813 GATCCTGCTCAGAGAGGGTGGGG + Intergenic
934165924 2:89294183-89294205 GATCCTGCTCAGAGAGGGTGGGG + Intergenic
934201353 2:89888273-89888295 GATCCTGCTCAGAGAGGGTGGGG - Intergenic
934209414 2:89962631-89962653 GATCCTGCTCAGAGAGGGTGGGG - Intergenic
934275532 2:91570853-91570875 CTGCCTGCACCGGGCGGGTGGGG - Intergenic
934553854 2:95277332-95277354 GACCCTGCTCAGGCTGGGTGTGG + Intronic
934658142 2:96127687-96127709 CCACCTACTCAGGGAGGCTGAGG - Intronic
934686613 2:96326090-96326112 CTCCCTGGGCAGAGAGGGAGAGG + Intronic
935360104 2:102239476-102239498 CCCCATGGTCATGGAGGGTGAGG + Exonic
935658350 2:105443947-105443969 TTCTCAGCTCAGGGAGGGAGAGG - Intergenic
936043039 2:109164296-109164318 CTAGCTACTCAGGGAGGCTGAGG - Intronic
936172711 2:110190443-110190465 CTCACTGCCCAGGGCCGGTGGGG + Intronic
936299332 2:111292702-111292724 CTCCCTGCGCAGGTAGGGTGTGG + Intergenic
936937243 2:117850202-117850224 CTCCCTCATCAGGAGGGGTGAGG - Intergenic
937566238 2:123292636-123292658 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
937853660 2:126657198-126657220 CTCCAAGCTCAGGCGGGGTGAGG - Intronic
938079443 2:128361853-128361875 CTCCCTGCTCAAGGAAGCTGGGG - Intergenic
938241803 2:129748061-129748083 ATCTCTGCTCAGGAAGGGTGGGG - Intergenic
938734842 2:134176455-134176477 CTAGCTACTCAGGGAGGCTGAGG + Intronic
938818534 2:134929763-134929785 CCAGCTACTCAGGGAGGGTGAGG - Intronic
938819133 2:134936636-134936658 CCACCTTCTCAGGGAGGCTGAGG + Intronic
939671256 2:145015423-145015445 CTCCCTGCTGAGCCAGTGTGAGG + Intergenic
942443931 2:176065876-176065898 CCAGCTGCTCAGGGAGGCTGAGG + Intergenic
942554228 2:177155180-177155202 CTCAGTGCTTAGGGAGGCTGAGG - Intergenic
942975698 2:182014955-182014977 CATCTTGCTCAGGGCGGGTGCGG + Intronic
943188534 2:184646501-184646523 ATCTCTGCACAGGAAGGGTGGGG - Intronic
944761327 2:202818124-202818146 CTCCCTACCCAAGGATGGTGGGG - Intronic
945230527 2:207584517-207584539 CTGACTACTCAGGGAGGCTGAGG - Intronic
945495001 2:210499163-210499185 ATCTCTGCACAGGCAGGGTGGGG + Intronic
946015846 2:216603225-216603247 CACCCTACACTGGGAGGGTGGGG + Intergenic
946522282 2:220479427-220479449 GTCCCAGCTGAGGGAGGCTGAGG + Intergenic
948412214 2:237772716-237772738 CTCTCAGCTCTGGGAGGTTGTGG + Intronic
948689311 2:239691889-239691911 GTCCCTGCTCCTGGAAGGTGGGG - Intergenic
1169343008 20:4810466-4810488 CTCCCTGATCATGGAGCGTTTGG - Intronic
1169515575 20:6312542-6312564 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1170874269 20:20235644-20235666 CTCCCTGCGGAGGGAGGATTAGG + Intronic
1172188045 20:33043790-33043812 CTCTCTGCTCTGGGAGGTGGGGG + Intronic
1172242652 20:33423529-33423551 CTTCCTCCTCAGGGAAGCTGAGG + Intronic
1172781329 20:37438508-37438530 CTCCCTGCTCTGGGCTGGGGAGG - Intergenic
1172963927 20:38819392-38819414 CTGGCTGCTTAGGGAGGCTGAGG + Intronic
1172964708 20:38826198-38826220 CTCCCTGTGAAGGGAGGGGGTGG + Intronic
1173222702 20:41142537-41142559 CTTCTTGCTGAGGCAGGGTGGGG + Intronic
1173615458 20:44400538-44400560 CTGCCTGCTCCGGGAGGGGGTGG + Intronic
1173985933 20:47261421-47261443 CTAGCTACTCAGGGAGGGTGAGG + Intronic
1174281942 20:49445803-49445825 CTCCCTGCTCTGGCAGGGAAAGG + Intronic
1175368522 20:58471332-58471354 CTCGGTGCTCAGCGAGCGTGTGG + Intronic
1175411953 20:58776311-58776333 CTGCCTGCTCGGGGTGGGTGGGG + Intergenic
1175834939 20:61987486-61987508 CTCCCTGGTGACGGAGGATGCGG - Intronic
1176187273 20:63787892-63787914 CTTCCTGGGCAGGGCGGGTGTGG - Intronic
1176674893 21:9768533-9768555 CCCGAAGCTCAGGGAGGGTGAGG - Intergenic
1176942474 21:14940571-14940593 CTTCCTTCTTAGAGAGGGTGAGG + Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179107192 21:38412483-38412505 CTCCCTACTTAGGGAGGCTGTGG + Intronic
1179501499 21:41812149-41812171 CTCCCTACTCTGGGAGGCTCTGG - Intronic
1179982771 21:44905241-44905263 CGCCCTGCTCTGGGAGCCTGTGG + Intronic
1180821579 22:18832556-18832578 CGCCCTGGCAAGGGAGGGTGTGG - Intergenic
1181036457 22:20171958-20171980 GGCCCTGCTCAGAGAGGCTGTGG - Intergenic
1181099951 22:20532340-20532362 CTGGCTGCTCAGGCAGGGTCGGG + Intronic
1181191399 22:21143489-21143511 CGCCCTGGCAAGGGAGGGTGTGG + Intergenic
1181207800 22:21267021-21267043 CGCCCTGGCAAGGGAGGGTGTGG - Intergenic
1181483950 22:23218927-23218949 GGCCCTGCTCAGGGAGGAAGCGG + Intronic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
1182351421 22:29702176-29702198 CTGCCTGCTCAGGGAGGAAGGGG + Intergenic
1182698274 22:32210914-32210936 GTTCCTGCTCAGGGAGGCAGTGG - Intergenic
1184302102 22:43567585-43567607 CTCATTGCTCAGGAAGGGAGCGG + Intronic
1184389097 22:44192720-44192742 CTCCCTGCCCACCGGGGGTGTGG + Intronic
1184459855 22:44630969-44630991 CTCCCTGACCAAGAAGGGTGGGG + Intergenic
1184819128 22:46895487-46895509 ATCCCAGCCCAGGGAGGCTGAGG - Intronic
1185232892 22:49693510-49693532 CTCCCAGTGGAGGGAGGGTGCGG + Intergenic
1203219121 22_KI270731v1_random:28395-28417 CGCCCTGGCAAGGGAGGGTGTGG + Intergenic
1203271704 22_KI270734v1_random:58432-58454 CGCCCTGGCAAGGGAGGGTGTGG - Intergenic
949932248 3:9088236-9088258 CTTCATGCACAGGGAGTGTGTGG + Intronic
950016353 3:9757459-9757481 CTCCCGGTTCAGGGAGGGAAGGG + Exonic
950461058 3:13122451-13122473 CTGGCTGTTCAGGGAGGGAGAGG + Intergenic
950505443 3:13391713-13391735 TCCCCTGCACAGGGAGGGAGAGG - Intronic
950581488 3:13865241-13865263 CTCCCTGCTCCTGGAGAGTCAGG - Intronic
951261291 3:20512397-20512419 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
951708155 3:25564952-25564974 CTCTCTTCTCTGGGAGCGTGGGG - Intronic
953027378 3:39152996-39153018 CTCCCCCCTCGGGGAGGCTGCGG - Intronic
953392248 3:42540485-42540507 CTCTCTGCACAGGGATGGTGGGG - Intergenic
953778234 3:45841851-45841873 TCCCCTTCTCAGGGAGGCTGAGG + Intronic
954106381 3:48411877-48411899 CCGCCTGCTCAGAGAGGATGTGG - Exonic
955362074 3:58284225-58284247 TTCCCTGCTGAGGGCTGGTGAGG - Intronic
955930541 3:64052067-64052089 CTCACTGGTGAGGGTGGGTGTGG + Intergenic
956420131 3:69079447-69079469 TTCCCTGCCCAGGCAGGGAGGGG + Intronic
958156432 3:89761540-89761562 ATCTCTGCACAGGAAGGGTGAGG + Intergenic
958539671 3:95454612-95454634 CTCCCAGCTCTGAGAGGCTGAGG + Intergenic
958836390 3:99149313-99149335 CTCACTGTTCAGGGTGGCTGGGG - Intergenic
959369216 3:105502699-105502721 TTCCCTGCACAGGGAGGCAGTGG - Intronic
960439299 3:117667078-117667100 CTGCATGCTGAGGGAGGGAGGGG - Intergenic
961173351 3:124814952-124814974 CTCCCTGCTGATGGGGAGTGGGG - Intronic
962258043 3:133885560-133885582 CTACCTGCTCAGGTTGGATGTGG - Intronic
962919251 3:139935913-139935935 CTCCCAGCTCGGGGATGGAGTGG + Intronic
963743015 3:149098104-149098126 CTCACTGCCCAGGGTCGGTGGGG + Intergenic
964482825 3:157159697-157159719 CACCGTGCCCCGGGAGGGTGGGG - Intronic
965142896 3:164862428-164862450 CTCCCTGTTGAGTGAGGGTGTGG + Intergenic
965520997 3:169668195-169668217 CGCCCTGCACAGGCGGGGTGGGG + Intergenic
966932956 3:184687557-184687579 TTCCCTGCCCTGGGAGGGTGTGG + Intergenic
968045480 3:195622006-195622028 CCCCCTGCTCCGGGAGAGAGCGG + Intergenic
968064276 3:195750027-195750049 CCCCCTGCTCCGGGAGAGAGCGG + Intronic
968491403 4:892386-892408 CTCCCTGCTCCCCGTGGGTGAGG + Intronic
968502475 4:957332-957354 CTCCCTCCACAGGGAGGCTGTGG - Intronic
969686042 4:8674821-8674843 TCCCCAGCTCAGAGAGGGTGGGG + Intergenic
969903834 4:10374475-10374497 CTTCCTGCCCAGAGAAGGTGTGG - Intergenic
969905974 4:10396282-10396304 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
972691815 4:41406510-41406532 CTCCCTGGAGAGGGAGGGAGGGG - Intronic
972733204 4:41815225-41815247 CAGCCTGCTCAGGGGGAGTGGGG - Intergenic
972824157 4:42737088-42737110 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
973073495 4:45894788-45894810 CTCCCTGTTCAGGGGGTCTGTGG - Intergenic
979603887 4:122616505-122616527 CTCCCAGCTCAGTTAGGGTTAGG + Intronic
979913764 4:126404687-126404709 ATCCCTGCACAGGAAGAGTGGGG - Intergenic
980616908 4:135240207-135240229 CACCATTCTCAGGGAGAGTGGGG - Intergenic
980701749 4:136441846-136441868 CACCCAGCTCTGTGAGGGTGGGG - Intergenic
981083333 4:140657147-140657169 CTCCTTGCTCAGCGATGATGTGG - Exonic
982647040 4:158037286-158037308 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
985063060 4:186097101-186097123 CTCCCTAAGGAGGGAGGGTGAGG - Intergenic
985520937 5:373691-373713 CCCCAGGCTCAGGGAGGGCGGGG + Intronic
985599395 5:818606-818628 CGCCCTGCTATGGGAGGCTGAGG + Intronic
985883417 5:2657687-2657709 CTACCTGCTGGGGGTGGGTGAGG - Intergenic
988998754 5:36739826-36739848 CTCCCTCCTCTGGGAGCCTGCGG - Intergenic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
989378552 5:40791052-40791074 CTCACTGCACAGTGATGGTGGGG - Intronic
990289218 5:54331542-54331564 CTCCCTCCTAAGGGAAGTTGGGG + Intergenic
990381769 5:55226779-55226801 TTCCCCGCGCCGGGAGGGTGCGG - Intronic
991456100 5:66806244-66806266 CTCCCTGCTCTGACAGGGTAAGG - Intronic
992878458 5:81081297-81081319 CTCCCTGGTCACAGAGGCTGTGG + Intronic
994671067 5:102762355-102762377 GTCCTTTCTCAGGCAGGGTGTGG + Intronic
995176892 5:109188297-109188319 CTCCCTCCTTTGGGAGGCTGAGG + Exonic
997542221 5:134672848-134672870 CCTGCTACTCAGGGAGGGTGAGG - Intronic
997589163 5:135062431-135062453 CTCCCTGCTGGGGTAGGGAGAGG + Intronic
997654045 5:135542400-135542422 CTCACTGCTGAGGAAGGGTGGGG - Intergenic
999295703 5:150458363-150458385 CTCCCAGCTCAGGCCGGGCGCGG + Intergenic
999639648 5:153659481-153659503 CTCCCTGCTCTGAGACTGTGGGG + Intronic
1001194619 5:169660861-169660883 CTCCCTTCTGAGTGAGGATGAGG + Intronic
1001494984 5:172181596-172181618 CCAGCTACTCAGGGAGGGTGAGG - Intronic
1002063727 5:176641896-176641918 CTCCCAGGTTGGGGAGGGTGGGG - Intronic
1002421249 5:179150193-179150215 CTCCCTGCCTGGGGTGGGTGCGG + Intronic
1002942501 6:1730524-1730546 CTTCTACCTCAGGGAGGGTGAGG - Intronic
1003369556 6:5510953-5510975 AGCCCTGCTGAGGGAGGGAGAGG - Intronic
1004599369 6:17132899-17132921 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1004957903 6:20750319-20750341 GTCCCTACTTTGGGAGGGTGAGG - Intronic
1006163202 6:32049815-32049837 CTCCCTGCTCAGGGGGAGCCAGG + Intronic
1006165459 6:32061975-32061997 CTCCCTGCTCAGGGGGAGCCAGG + Intronic
1006720095 6:36144649-36144671 CTCCATGATCATAGAGGGTGGGG - Intergenic
1006973822 6:38077177-38077199 CTCTCTGCCCAGGGAGGCTTAGG + Intronic
1007108021 6:39296701-39296723 CTCACCGGTCAGAGAGGGTGGGG + Intergenic
1007417877 6:41702636-41702658 GTCCCTCCCCAGGGAAGGTGAGG + Intronic
1007623055 6:43226467-43226489 CTCCCTGAGCAGGGTGGGTATGG - Intronic
1007738727 6:43998206-43998228 CTCACTGCCCAGGGCCGGTGGGG - Intergenic
1008231378 6:48988233-48988255 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
1009590421 6:65662632-65662654 ATCCATGCTCAGGGTGGATGTGG + Intronic
1011129348 6:84037736-84037758 CTCACTGCCCAGGGCTGGTGGGG + Intronic
1011954987 6:93015640-93015662 ATCCCTGCTCAGGAAGGGTGGGG - Intergenic
1011957209 6:93037746-93037768 GTCTCTGCACAGGAAGGGTGGGG + Intergenic
1013255391 6:108379931-108379953 CTCTCTGCACAGGAAGAGTGGGG + Intronic
1013255439 6:108380156-108380178 ATCTCTGTTCAGGAAGGGTGGGG + Intronic
1015306580 6:131715586-131715608 ATCCCTGCACAGGAAGGATGGGG - Intronic
1015350290 6:132210176-132210198 ATCTCTGCACAGGCAGGGTGGGG + Intergenic
1015485308 6:133763378-133763400 CTCCTTGCTGTGGGAGGGTGGGG + Intergenic
1015707501 6:136104046-136104068 CCCTGTCCTCAGGGAGGGTGAGG + Intronic
1016220847 6:141668459-141668481 ATCTCTGCCCAGGAAGGGTGGGG - Intergenic
1016291208 6:142530228-142530250 CTCCCTGCTCAAGGAGAGAGAGG - Intergenic
1016467473 6:144340246-144340268 CTCCCTGGTGTTGGAGGGTGTGG + Intronic
1017208667 6:151831388-151831410 CTCACTGCTCTGGAAGGCTGCGG - Intronic
1017755934 6:157529222-157529244 CTCCCTGTGAAGAGAGGGTGGGG - Intronic
1018024029 6:159790004-159790026 GTCCCTGCTCGGGGAGCGTGAGG + Intronic
1018046631 6:159970960-159970982 CTCCCAGTTAAGGGAGGCTGAGG + Intronic
1018067774 6:160135652-160135674 CTGCATGCTCAGGCAGGGTGAGG + Intronic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1018380424 6:163253886-163253908 CTCCCAGCTCTGAGAGGGAGGGG + Intronic
1018660388 6:166080730-166080752 CTCGCTGCTCAGGGAGAGAAAGG - Intergenic
1018710546 6:166495509-166495531 CTCCAGGGACAGGGAGGGTGGGG + Intronic
1018748721 6:166782679-166782701 CAGCCTGCTCTGGGAGGGAGCGG + Intronic
1018798744 6:167206907-167206929 CTCCCTGATCAGCCAGGCTGGGG + Intergenic
1019715896 7:2539190-2539212 CTGCATGCTCAGGGCTGGTGGGG + Exonic
1020051579 7:5085484-5085506 CTCACACCTCAGGGAGGGAGTGG + Intergenic
1020219195 7:6221746-6221768 CTCAATACTCAGGGAGAGTGAGG + Intronic
1020220021 7:6229032-6229054 CCCTCTGCTCAGAGGGGGTGTGG - Intronic
1022019937 7:26388893-26388915 CTCCCTTCCCTGGGAGGCTGAGG + Intergenic
1022097730 7:27151365-27151387 CTCCCCGCTCGCGGAAGGTGGGG + Intronic
1022103407 7:27182434-27182456 CTCCCAGTAGAGGGAGGGTGTGG + Exonic
1024051088 7:45623903-45623925 ATCCCTGCCCTGTGAGGGTGTGG + Intronic
1026891706 7:73986255-73986277 ATCCCAGCTCAGGGAGGGTGGGG + Intergenic
1026943706 7:74303180-74303202 TGCCCTGGTCAGGGAGGATGTGG + Intronic
1027121077 7:75520865-75520887 ATCCCAGCTGAGGGAGGCTGAGG + Intergenic
1027673350 7:81129497-81129519 CTCCCTGCTCAGCCACGGAGGGG + Intergenic
1028304550 7:89246863-89246885 ATCTCTGCACAGGAAGGGTGGGG - Intronic
1028800557 7:94960369-94960391 CTCTATGCTGAGGGAGGGAGGGG + Intronic
1029084257 7:97998886-97998908 ATCCCAGGTCAGGCAGGGTGCGG + Intergenic
1029446401 7:100615208-100615230 GACCCTGCCCAGGGAGGGTGGGG - Exonic
1029535442 7:101154855-101154877 CTCTTTGCTGAGGGAGGGAGCGG + Intronic
1029666830 7:102000883-102000905 CCATCTACTCAGGGAGGGTGAGG - Intronic
1031039783 7:116827239-116827261 CTCAGTGCTTTGGGAGGGTGAGG - Intronic
1031665327 7:124476379-124476401 CTCCCCACTCAGGGTGGCTGTGG + Intergenic
1032002733 7:128275880-128275902 CACCCTGCCCTGGGAGAGTGTGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033325120 7:140371289-140371311 ATCCCAGCTGAGGGAGGCTGAGG - Intronic
1033652925 7:143355693-143355715 ATCCCTGCTCCGGGAGCCTGAGG - Exonic
1033730969 7:144178914-144178936 ATCCCTGCACAGGAAGGATGGGG + Intergenic
1034533583 7:151712735-151712757 CGCTGTGCTGAGGGAGGGTGTGG + Intronic
1034962868 7:155373363-155373385 CTCCCTGCGGAGGGACTGTGTGG - Intergenic
1035198061 7:157239766-157239788 CACCCTGCAAAGTGAGGGTGTGG + Intronic
1035262380 7:157670142-157670164 CTTCCTGCTCTGGGGAGGTGAGG + Intronic
1035320927 7:158028824-158028846 CTGCTGGCTCAGGGAGCGTGGGG + Intronic
1036416107 8:8550181-8550203 CTCCCACTTCAGGGAGGATGTGG + Intergenic
1036787301 8:11696894-11696916 CCATCTGCTCAGGGAGAGTGTGG + Intronic
1037821532 8:22137486-22137508 CTTCCAGGTCAAGGAGGGTGGGG - Intergenic
1037849206 8:22312514-22312536 CTCACTGCTTTGGGAGGTTGAGG - Intronic
1038479276 8:27890668-27890690 CCACCTGCTCAGGGTGGGAGGGG + Intronic
1038488547 8:27953290-27953312 CTTCCTGCCCACGGAGGATGCGG + Intronic
1038538824 8:28374196-28374218 CACCCTGTTGAGGGAGGGAGAGG + Intronic
1039841765 8:41298663-41298685 CTCAATGCTTTGGGAGGGTGAGG - Intronic
1040106764 8:43546102-43546124 CTCCCACATCAGGGTGGGTGGGG - Intergenic
1040107116 8:43547429-43547451 CTCCCATCTCAGGGTGTGTGAGG - Intergenic
1040512620 8:48108447-48108469 CTCCCAAGTCAGGGAGGCTGTGG - Intergenic
1040530619 8:48263657-48263679 CTCCCTGGTGGGGGCGGGTGGGG + Intergenic
1040961646 8:53040077-53040099 CTCCATGCTCAAGTAGGGTCTGG + Intergenic
1042109652 8:65367332-65367354 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1042319316 8:67458310-67458332 CCAGCTACTCAGGGAGGGTGAGG - Intronic
1042829953 8:73016000-73016022 ATCCCAGCTCTGGGAGGCTGAGG + Intronic
1044404884 8:91816470-91816492 CTCACTGCCCAGGGCTGGTGGGG - Intergenic
1044523918 8:93230134-93230156 CTCGCTGCTCAGGGAGAGAATGG - Intergenic
1044785405 8:95787669-95787691 CTTCCTTTTCAGGGAGAGTGAGG - Intergenic
1045094628 8:98784912-98784934 ATCTCTGCACAGGAAGGGTGAGG - Intronic
1045727031 8:105186006-105186028 ATCTCTGCACAGGAAGGGTGGGG + Intronic
1046816760 8:118592973-118592995 TTCTCTTCTCAGGGAGGGTGGGG + Intronic
1047169688 8:122479847-122479869 CTTCCTTCTCAGGGAGGAAGAGG - Intergenic
1047193055 8:122696020-122696042 GTCACTGCTCGGGGAGGCTGAGG + Intergenic
1047482962 8:125302072-125302094 ATCCCAGCTCTGGGAGGCTGAGG - Intronic
1049271497 8:141698566-141698588 CTCCCTGCTCACTCAGAGTGGGG + Intergenic
1049377232 8:142295060-142295082 CTCTCAGCTCAGGCAGGGAGGGG + Intronic
1049418982 8:142508537-142508559 CACTCTGCTCAGGGAGAGGGTGG + Intronic
1049425579 8:142536561-142536583 CTCACTGCCCTGGGAGTGTGGGG - Intronic
1049644705 8:143730841-143730863 CTCCTTTCTCTGGGAGGCTGAGG + Intronic
1049983179 9:923429-923451 TTACCTGCTGAGAGAGGGTGAGG + Intronic
1050263521 9:3866219-3866241 CTCTGTGCTCAGGGAGACTGGGG + Intronic
1050619038 9:7433635-7433657 ATCTCTGCACAGGAAGGGTGTGG + Intergenic
1050619058 9:7433748-7433770 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1050687854 9:8191327-8191349 CTCACTGCTCAGCCTGGGTGAGG - Intergenic
1051920317 9:22257138-22257160 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1053592974 9:39533134-39533156 CTCCCTGCTCTGAGATGTTGGGG - Intergenic
1054573332 9:66832143-66832165 CTCCCTGCTCTGAGATGTTGGGG + Intergenic
1057294909 9:93829312-93829334 TTCCCTGCTCTGGGAAGTTGAGG + Intergenic
1057679466 9:97164961-97164983 CTAGCTGCTCAGGAGGGGTGAGG + Intergenic
1057851007 9:98566729-98566751 CCAGCTGCTCAGGGAGGCTGAGG + Intronic
1058091270 9:100808449-100808471 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1059173983 9:112152515-112152537 CTAGCTACTCAGGGAGGTTGGGG - Intronic
1060299040 9:122363278-122363300 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1060301149 9:122375273-122375295 CTCTCTTGGCAGGGAGGGTGTGG + Intronic
1060353458 9:122880860-122880882 TTCCTTTTTCAGGGAGGGTGGGG + Intronic
1060422450 9:123479041-123479063 CTCTCCTCTCAGAGAGGGTGGGG + Intronic
1060509424 9:124221283-124221305 CCCTCTGCTTAGGGAGGGAGTGG + Intergenic
1062020360 9:134316418-134316440 CTCCCTGCTCTGTGAGTGTCTGG + Intergenic
1062395577 9:136351326-136351348 CTCCAGGCCCAGGGAGGCTGGGG - Intronic
1062536950 9:137025277-137025299 CCCCCAGCTCAGGGAGGAGGAGG + Intronic
1062560855 9:137141293-137141315 CTCCCTGCCTTGGGAGGCTGGGG + Intronic
1062590138 9:137270801-137270823 ATCCCAGCTGAGGGAGGCTGAGG + Intronic
1185462251 X:338768-338790 CTCCCTGCTCAGGGTGAGTGCGG - Exonic
1185586106 X:1243100-1243122 CTTCCTGGGCGGGGAGGGTGGGG - Intergenic
1185731176 X:2463198-2463220 CTCCCTACTCAGAGAGGCTGTGG + Intronic
1186125868 X:6413304-6413326 CTCCTTGCTAAGGAAAGGTGAGG + Intergenic
1186465164 X:9779219-9779241 TACCCTGCTCAGGCAGGGGGTGG + Intronic
1187249531 X:17584293-17584315 CTCCCTCCCCAGGGAAGGGGTGG - Intronic
1188806010 X:34590643-34590665 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1189196807 X:39160345-39160367 CTCCCTGCATGGGCAGGGTGGGG + Intergenic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1190689469 X:52901387-52901409 ATCCCTGCTTCGGGAGGCTGAGG - Intronic
1190696514 X:52954405-52954427 ATCCCTGCTTCGGGAGGCTGAGG + Intronic
1190817865 X:53944515-53944537 CCCATTGCTCTGGGAGGGTGAGG + Intronic
1192227383 X:69238572-69238594 CTCCCTGGGAAGGGAGGCTGTGG + Intergenic
1192244783 X:69363131-69363153 CTCACTGATGAGGGAGGGAGAGG + Intergenic
1194051896 X:89079581-89079603 GTGGCTGCTCAGGGAGGGGGAGG - Intergenic
1194172229 X:90601641-90601663 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1194327948 X:92543660-92543682 ATCCCAGCTGAGGGAGGCTGAGG + Intronic
1194923577 X:99796468-99796490 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1195857305 X:109345132-109345154 CTCACTTCTCAGGGAGGTTAGGG + Intergenic
1196245782 X:113397942-113397964 TTGCCAGCTCAGGGAAGGTGTGG - Intergenic
1196613795 X:117743755-117743777 CTCCCAGTTCAGGGAGCTTGGGG + Intergenic
1197161765 X:123331559-123331581 CTATCTGCTGAGTGAGGGTGAGG - Intronic
1197412758 X:126139144-126139166 GTCTCTGCACAGGAAGGGTGAGG + Intergenic
1198571933 X:137966689-137966711 CTCCCAGATCTGGGAGGATGTGG - Intergenic
1198913739 X:141642461-141642483 CCAGCTACTCAGGGAGGGTGAGG - Intronic
1199734731 X:150674952-150674974 CCATCTGCTCAGTGAGGGTGTGG + Intergenic
1199830548 X:151545380-151545402 CCAGCTGCTCAGGGAGGCTGAGG - Intergenic
1199990783 X:152986562-152986584 CTCCTTGCTCTGGGCTGGTGGGG + Intergenic
1200033872 X:153316036-153316058 CTCCTTGCTCTGGGCTGGTGGGG + Intergenic
1200518460 Y:4179377-4179399 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1200636661 Y:5662871-5662893 ATCCCAGCTGAGGGAGGCTGAGG + Intronic