ID: 1018079951

View in Genome Browser
Species Human (GRCh38)
Location 6:160250662-160250684
Sequence TTATGAGGACTGTAGTTAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018079945_1018079951 24 Left 1018079945 6:160250615-160250637 CCACGTATAGGTTGGGGAAATGG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1018079951 6:160250662-160250684 TTATGAGGACTGTAGTTAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1018079947_1018079951 1 Left 1018079947 6:160250638-160250660 CCATGAGAACTCCAGCTGCAGCA 0: 1
1: 0
2: 0
3: 33
4: 231
Right 1018079951 6:160250662-160250684 TTATGAGGACTGTAGTTAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1018079949_1018079951 -10 Left 1018079949 6:160250649-160250671 CCAGCTGCAGCATTTATGAGGAC 0: 1
1: 0
2: 0
3: 17
4: 111
Right 1018079951 6:160250662-160250684 TTATGAGGACTGTAGTTAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018079951 Original CRISPR TTATGAGGACTGTAGTTAGG AGG Exonic
902586668 1:17443467-17443489 TTCTGAGGACAGTAGTCAGCGGG + Intergenic
905361879 1:37426411-37426433 TTATGGGGCCTGTAGTTAAGTGG - Intergenic
908453699 1:64281413-64281435 TTAAGAGGAGTGGAGCTAGGCGG + Intergenic
909977329 1:82060348-82060370 TTGTGAGGACTGTGGCCAGGTGG - Intergenic
911507296 1:98768680-98768702 TCATGAGAAGTGTAGTTAGCAGG - Intergenic
912847955 1:113093608-113093630 TTATGGGGACTGTTGTGGGGTGG + Intronic
913339932 1:117748511-117748533 TTGTGAGGACAGTACTAAGGGGG - Intergenic
915043248 1:152985895-152985917 TTGTGAGGTCTGTAGTCAGAAGG + Intergenic
915653742 1:157340443-157340465 CTCTGAGGACTGTTGTTGGGTGG - Intergenic
915861211 1:159446586-159446608 TTCTGTGGACTGGAGATAGGAGG + Intergenic
916321217 1:163506507-163506529 TTGTGAGGATTGTTGTGAGGTGG - Intergenic
916999428 1:170340245-170340267 TTATGGGGACTGTGCTTTGGAGG - Intergenic
1063508166 10:6620338-6620360 TTAGGAGGAATGTAGTCATGGGG + Intergenic
1068147935 10:53095315-53095337 TTATGTGGACTATATTTATGTGG + Intergenic
1069388034 10:67902612-67902634 TTATGAGGACTCTCCTTAGCAGG + Intronic
1071347501 10:84706677-84706699 TTCTCAGGAATGTGGTTAGGAGG + Intergenic
1072839288 10:98753032-98753054 TGCTGAGGACTTTAGTTGGGAGG + Intronic
1074016891 10:109543302-109543324 TTTTAAAGACTGTAGTGAGGTGG + Intergenic
1083670224 11:64295819-64295841 TAATGAGGACTTCAGTCAGGGGG + Intronic
1085531133 11:77192671-77192693 TTCTGAGGACAGGAGTTATGTGG + Intronic
1089159276 11:116424999-116425021 ATAAGAGGACTGGAGTTTGGTGG - Intergenic
1090087995 11:123668030-123668052 TTAGGAGGACTGTAGTTGGAGGG + Intergenic
1091335679 11:134764004-134764026 ATATGAGGACTGTGGTGAGCAGG - Intergenic
1093305129 12:17507499-17507521 TTCTGAGAACTGTGATTAGGAGG - Intergenic
1093637928 12:21493734-21493756 TTGTGGGGACTTCAGTTAGGAGG - Intronic
1094212045 12:27903121-27903143 TGATGAGGCCTGTATTAAGGTGG - Intergenic
1103495109 12:121355901-121355923 TGATGAGGATTGTAGTGAGTTGG - Intronic
1106865729 13:33961682-33961704 TTAAGGGGACTGCAGTTAGGAGG + Intronic
1107679456 13:42833164-42833186 TTCTGAGGACTGAAGTTATAAGG - Intergenic
1110309078 13:74025893-74025915 TTATGGGGACTCTAGAGAGGTGG - Intronic
1110630594 13:77701923-77701945 TTCTGGGGACTGTAGTGGGGTGG - Intronic
1114396916 14:22372207-22372229 GTATGAGGACTGGAGTTTGTGGG - Intergenic
1114962495 14:27911220-27911242 TCATGAGGACAGTACTAAGGAGG - Intergenic
1115713076 14:36072007-36072029 ATATAAGGATTGTTGTTAGGAGG - Intergenic
1118390206 14:65289167-65289189 TTATTATGACTGCAGTTAGTCGG - Intergenic
1120098136 14:80412349-80412371 TTTTGAGGTCTGGAGTTTGGGGG - Intergenic
1125881950 15:43202855-43202877 TTATGATCCCTGTAGGTAGGAGG + Intronic
1127392028 15:58513533-58513555 TTCTGAGGTCTGTTTTTAGGGGG - Intronic
1127853871 15:62938911-62938933 TTATGGGGAATGTGGTTAAGAGG - Intergenic
1134001682 16:10787760-10787782 ATATGAGGAGTGAATTTAGGAGG - Intronic
1138438842 16:57022314-57022336 TGGTGAGGACTGGAGTTGGGGGG + Exonic
1140884578 16:79231730-79231752 TTCTGTGGACCGGAGTTAGGTGG + Intergenic
1141239393 16:82250941-82250963 TTATGTGGAATCTATTTAGGAGG - Intergenic
1142654924 17:1385365-1385387 TTTTGAGGCATGTAGTTGGGAGG - Intronic
1143042888 17:4052367-4052389 TTATCAGGACTGCTGTTTGGTGG + Intronic
1146421308 17:32688515-32688537 TTGGGAGGACTTTAGTGAGGAGG + Intronic
1149207927 17:54270037-54270059 TTGTAAGGAATGTAGTTAGCTGG + Intergenic
1153700991 18:7693100-7693122 TTATGATGACTGTGGCTAGCAGG + Intronic
1155737948 18:29247415-29247437 TTATGAGGAGTGGAGGTAGATGG - Intergenic
1157463536 18:47924403-47924425 TTATGAGGATTTTATATAGGAGG + Intronic
1166278567 19:41773946-41773968 TTGTGAGGACTGTAGCTAGCTGG - Intergenic
1166429324 19:42710877-42710899 TGGTGAGGACTGTAGTTACCTGG + Intronic
1166479937 19:43162941-43162963 TTGTGAGGAGTGTAGTTACCTGG + Intronic
1166489759 19:43248472-43248494 TGGTGAGGACTGTAGTTACCTGG + Intronic
925775180 2:7328306-7328328 TCATGAGGACAGTACCTAGGGGG - Intergenic
933886947 2:86727246-86727268 ATATGAGCATTATAGTTAGGAGG - Intronic
933923231 2:87069462-87069484 ATATGAGCATTATAGTTAGGAGG + Intergenic
935323396 2:101910750-101910772 TCATGAGGACTGGACTTAAGGGG + Intergenic
936583990 2:113735944-113735966 TTGTGAGAACGGTATTTAGGAGG - Intronic
936952662 2:117993694-117993716 TCATGAGAAATGTAGTTAGCAGG + Intronic
937655780 2:124373709-124373731 TTATGAGCAATGTGATTAGGAGG + Intronic
937726861 2:125176639-125176661 TTATGAGGACAGTACCAAGGGGG - Intergenic
939486267 2:142815004-142815026 TTCTCAGGCCTGTAGTTTGGCGG - Intergenic
940454358 2:153876917-153876939 TCATGAGGACTCTAATTACGTGG - Intronic
943418983 2:187643725-187643747 TTATGAATACTGTAGTTGAGTGG + Intergenic
943867583 2:192947242-192947264 TTATGAGGAATGTATTTATTTGG - Intergenic
947152423 2:227129253-227129275 TGATGAGGACTGCAGTTAAATGG - Intronic
948321665 2:237074635-237074657 TTATGAGGACTGCACATAGCAGG - Intergenic
948612947 2:239181172-239181194 TTGTGAGGGCTGTAGGTGGGTGG - Intronic
1169675941 20:8155023-8155045 TTATGAGGACTGGTGTAAGGTGG + Intronic
1172448279 20:35004317-35004339 TTCTGAGGACTGTGCTCAGGAGG - Intronic
1176212182 20:63930151-63930173 TTATAAGGATTCTAGTGAGGAGG - Intronic
1177225201 21:18244965-18244987 TTTGGGGGACTGAAGTTAGGGGG - Exonic
1179446661 21:41436601-41436623 GTAGGAGGACTGTTGTAAGGTGG + Intronic
1179771911 21:43626434-43626456 TTGTGAGGAATGTAGATATGCGG + Intronic
1181455019 22:23054237-23054259 TTCTGTGGACTGGAGTCAGGAGG + Intergenic
954784078 3:53080533-53080555 TTCTGTGGACTGGGGTTAGGTGG + Intronic
959240430 3:103785053-103785075 TTACGAGGAAGTTAGTTAGGTGG - Intergenic
959820818 3:110733382-110733404 TTGTGATGACAGTAGTCAGGTGG - Intergenic
962880795 3:139574588-139574610 TTACTAGAACTGTATTTAGGGGG + Intronic
963218303 3:142776249-142776271 TTTTGAGGATTGCAGTTGGGAGG + Intronic
974027403 4:56745887-56745909 CTCTGAGGACTGTTGTGAGGTGG + Intergenic
977110434 4:92945884-92945906 TGAAGAGGACTGAAGTTAAGGGG - Intronic
977278811 4:95013119-95013141 TTATGTGCCCTTTAGTTAGGAGG + Intronic
981634052 4:146854728-146854750 TTACAAGAACTGCAGTTAGGAGG - Intronic
982826689 4:160011239-160011261 TGTTGAGGACAGAAGTTAGGAGG + Intergenic
983875015 4:172865352-172865374 TTATCAGGACTGTAGTCTTGTGG - Intronic
984473975 4:180214303-180214325 TTATGAGAACTATAGTTAGAGGG - Intergenic
985611985 5:894298-894320 TTAGGAGGACTGCAGCAAGGGGG + Intronic
988715763 5:33826039-33826061 TTATGTGAACTGCAGTTAGGAGG + Intronic
988852101 5:35190293-35190315 TTTTTAGTACTGTAGTTAAGAGG - Intronic
990694408 5:58399893-58399915 TTACAAGGAGTGTAATTAGGAGG - Intergenic
990925027 5:61011214-61011236 TTATGAGTATTTTTGTTAGGAGG + Intronic
991226426 5:64278484-64278506 TTATGAGAACTGAACTGAGGTGG + Intronic
994921504 5:106050055-106050077 TTCTCAGGACTGTAGGTAGCAGG + Intergenic
995346529 5:111126479-111126501 GTATCAGGACTGTCCTTAGGTGG + Intronic
999574217 5:152956188-152956210 TTATGAGAACTTTAGTTTGCAGG + Intergenic
1001894048 5:175363650-175363672 TTCTGGGGGCTGTAGGTAGGTGG - Intergenic
1006061229 6:31421389-31421411 TTGTGAGACCTGTAGTTAGAGGG - Intergenic
1007067725 6:39008947-39008969 TCATGAGGAATGTAATCAGGAGG - Exonic
1007330679 6:41105187-41105209 TGAGGAGGACTATATTTAGGTGG + Intergenic
1009826431 6:68871071-68871093 ATATGAGGAATGTACTAAGGCGG + Intronic
1011318158 6:86059599-86059621 TTATCAGGAATGTAATTTGGTGG + Intergenic
1018079951 6:160250662-160250684 TTATGAGGACTGTAGTTAGGAGG + Exonic
1018135976 6:160778797-160778819 TTATGAGAACTGTAGAGAGTGGG - Intergenic
1019832715 7:3349259-3349281 TTATGAGGGCTGTGGTTTTGTGG + Intronic
1021346448 7:19534850-19534872 TTCTGAGCTCTGTAGTTAAGTGG - Intergenic
1024457482 7:49626097-49626119 CTATGGGGACTGTAGTGGGGTGG - Intergenic
1026638909 7:72107199-72107221 TCCTGAGGACTGCAGTTAAGAGG - Intronic
1028915433 7:96253591-96253613 TTATCAGGACAGCAGTTAGCAGG + Intronic
1030926217 7:115458476-115458498 TTATAAGGAATGTAGTTTGGGGG + Intergenic
1034687396 7:152984955-152984977 TTATGAGGACACTAGTCAGGCGG + Intergenic
1036990416 8:13586194-13586216 TTATGATGACTGTTTTAAGGTGG + Intergenic
1041362641 8:57068941-57068963 TTCAGAGGAATGTGGTTAGGGGG - Intergenic
1041415070 8:57598983-57599005 TTTTGAGGAGTTTAGTTTGGAGG - Intergenic
1041597335 8:59670945-59670967 TTATGAGGAATGTACTTATGAGG - Intergenic
1044901181 8:96946593-96946615 TTATGGGGACTGTTGTGGGGTGG - Intronic
1047632645 8:126725120-126725142 ATATGAGGACTGGAGTTTGCAGG + Intergenic
1059477358 9:114558250-114558272 TTATGAGAACAGCAGTTTGGAGG - Intergenic
1059808311 9:117828549-117828571 TGACTAGGACTGTAGTGAGGGGG + Intergenic
1059811767 9:117862911-117862933 TCATGAGGCCTGTACTAAGGTGG - Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1187252338 X:17609873-17609895 TTCTGAGGACTCTAGCTTGGTGG + Intronic
1187333704 X:18363627-18363649 TTATAAGGACTGAAGTGAGAGGG - Intergenic
1187740951 X:22355034-22355056 TTTTGAGGACTGTAATCATGTGG + Intergenic