ID: 1018082741

View in Genome Browser
Species Human (GRCh38)
Location 6:160272347-160272369
Sequence CTGAATATACACATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 16, 2: 57, 3: 78, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018082741_1018082743 0 Left 1018082741 6:160272347-160272369 CCATTGTCCATGTGTATATTCAG 0: 1
1: 16
2: 57
3: 78
4: 315
Right 1018082743 6:160272370-160272392 TCTCTCCCAAGCTAGTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018082741 Original CRISPR CTGAATATACACATGGACAA TGG (reversed) Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
907536146 1:55160026-55160048 CTGAATATAAACACAGACCATGG + Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909142389 1:71884815-71884837 CTTTAAATTCACATGGACAAAGG + Intronic
909404969 1:75278064-75278086 CTGAATAGACACATGGGTAGTGG - Intronic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909506706 1:76399379-76399401 CTGAATAACCTCATGGAAAAAGG - Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
910964233 1:92791998-92792020 TTGAATATACACATTCACAGAGG - Intronic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915429308 1:155853419-155853441 CTTAATATACACATTGGTAAAGG - Exonic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
918462236 1:184788708-184788730 CCGAAAAAACACATGGACACAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923989208 1:239415973-239415995 CTGAATATACACATGGTAGCAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063222946 10:3987899-3987921 CTTAAGATAGACATGGAAAAAGG - Intergenic
1063336008 10:5214536-5214558 CTGAATATTCATATGGTCTATGG - Intronic
1063429993 10:5979851-5979873 ATGGACATACACATGGAAAAGGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1065238939 10:23686204-23686226 CTGACTATAGACATTTACAAAGG + Intergenic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066498754 10:35970038-35970060 ATGAACATAAACATGGACACTGG + Intergenic
1066538586 10:36419348-36419370 TTGAATATACACATAGCCTATGG + Intergenic
1066645582 10:37604957-37604979 TTGAATATACACATAGCCTATGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1068822674 10:61395804-61395826 CTGCACATTCACATGCACAAGGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071282768 10:84117552-84117574 GTGAATGCACACTTGGACAAGGG - Intergenic
1071282869 10:84118667-84118689 GTGAATGCACACTTGGACAAGGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071991378 10:91103750-91103772 CTGAAGGTACTCATGGCCAAAGG - Intergenic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075542454 10:123326428-123326450 CTGAATAGACTCAAGGACACTGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1078340156 11:10492890-10492912 CTGAAGAAACACGTGGGCAAAGG + Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078612075 11:12829609-12829631 CTCAATAAATACATGGATAAAGG - Intronic
1080337827 11:31219423-31219445 CTGAATATAAACATGAGCAGAGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083837370 11:65280156-65280178 TTGAATGTAAACATTGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087425289 11:97977946-97977968 CTGAATTGACACCTGGATAAAGG - Intergenic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088302234 11:108371593-108371615 CAGTATATACACATACACAATGG - Intronic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088590419 11:111398253-111398275 CTGAAACTACACTTGGTCAATGG - Intronic
1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG + Intergenic
1092400395 12:8171397-8171419 ACGAATATATACATGGACATCGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094756817 12:33480571-33480593 CTGAATAGCCACATGCAAAAGGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095150858 12:38795362-38795384 TTGAATATACACATGGAAGTGGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098267905 12:68741353-68741375 TTGCTTATACACATGGAAAATGG - Intronic
1098759963 12:74410989-74411011 CTGAAAATATCCATGGACAATGG - Intergenic
1098944715 12:76576741-76576763 CTGAATAACCACTTGGTCAAAGG + Intergenic
1099639228 12:85263519-85263541 CTGAAAATAAACAGTGACAAAGG + Intergenic
1099702864 12:86110348-86110370 CTATATATACACATAGTCAAGGG + Intronic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1101693900 12:107106692-107106714 ATCAATATGCACATGGACATGGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1103186922 12:118966226-118966248 CTGAGAACACACATGGACACAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107098123 13:36558773-36558795 CTGGATTTACACATGGAAATGGG + Intergenic
1107541572 13:41393937-41393959 GTGAGTACACACCTGGACAAGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110005474 13:70261164-70261186 ATGATTATTCACATGGAAAATGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113529019 13:111006331-111006353 CGAAATGTACACATGGACAGTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115211632 14:30972423-30972445 GTGAACGTACACTTGGACAAGGG - Intronic
1115417226 14:33149978-33150000 ATGAAAACACACATGGACACAGG - Intronic
1115466715 14:33723026-33723048 CAGAATATACACATTCACACGGG + Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118670288 14:68118649-68118671 CTCAAAATACACCTGCACAATGG - Intronic
1122106888 14:99464664-99464686 CATAATCTAAACATGGACAAAGG + Intronic
1122137441 14:99642880-99642902 CTGAATATTGACAAGGACATTGG - Intergenic
1122305140 14:100760562-100760584 CTGACTATCCACATGCAGAAAGG + Intergenic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124553020 15:30699569-30699591 CTGTATATAGTCATTGACAATGG - Intronic
1124678223 15:31706101-31706123 CTGTATATAGTCATTGACAATGG + Intronic
1125909142 15:43420811-43420833 CTGAGGAGACCCATGGACAAAGG - Intronic
1127384373 15:58455123-58455145 CTGTATTTATACATGGACATTGG + Intronic
1127898900 15:63326715-63326737 CACAATAAAAACATGGACAAAGG + Intronic
1129196385 15:73969700-73969722 CTGAACATACACGTGCACCATGG - Intergenic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131105566 15:89731759-89731781 CTCAATAAACACATGGGCAGTGG - Intronic
1131697470 15:94893720-94893742 CTCAATATTGACATTGACAATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134811767 16:17173575-17173597 CTCAATGCACACAGGGACAAAGG + Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1146904278 17:36608220-36608242 CTGCACAGACACAAGGACAAGGG - Intronic
1147207336 17:38847032-38847054 CAGAATATAAACAGTGACAAAGG + Intergenic
1147441973 17:40452975-40452997 CTGAATACAGACAAGGACGAGGG + Exonic
1148667169 17:49383366-49383388 CTGAATATTCCCATGGAAACTGG - Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159114455 18:64098172-64098194 CTGAATATTGACATAGAAAAAGG - Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639032 19:5408336-5408358 CTGGATATCCACATGCAAAAGGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1167794203 19:51698655-51698677 CTGGATATACACTTGGAGAGAGG - Intergenic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925735271 2:6958317-6958339 CAGAACAGACACACGGACAAGGG + Intronic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928870137 2:35966199-35966221 GTGGATATAAACATGGAAAAGGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
932397281 2:71456631-71456653 ATGAATGTATACATGCACAAAGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940802257 2:158145591-158145613 GTGAGTACACACTTGGACAAGGG - Intergenic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942575339 2:177357185-177357207 TTGAAAATACTCTTGGACAAAGG + Intronic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
943501703 2:188698394-188698416 CAGGACATACACATGGGCAAAGG - Intergenic
943633850 2:190283443-190283465 GTGAGCATACACCTGGACAAGGG - Intronic
943714306 2:191133515-191133537 CTGCATATATACATGTATAAGGG + Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943948053 2:194092785-194092807 CTGAAAATATGCATTGACAATGG - Intergenic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946845294 2:223853591-223853613 CTGAACCTACACATGGTCATAGG - Intergenic
947556820 2:231100284-231100306 GTGAACACACACTTGGACAAGGG + Intronic
947772241 2:232679765-232679787 CTGAATAGAAACGTGGGCAAAGG + Intronic
947861619 2:233362804-233362826 ATGATGATCCACATGGACAAAGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1168823340 20:792164-792186 GTGAGTGTACACCTGGACAAGGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170660217 20:18331578-18331600 CTAATTACACACATGTACAATGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172991332 20:39039109-39039131 CTGCAGATAAACAGGGACAAGGG - Exonic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174358526 20:50014102-50014124 CTGTAAAGAGACATGGACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178629344 21:34245676-34245698 CTGATTCTATACATGGACGATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181402536 22:22660003-22660025 CTGAATCTACACCTAGACCAAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953017785 3:39094913-39094935 CTTAATCTACACATGGAGACTGG - Exonic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953332747 3:42067832-42067854 TTGAAAATTCACATGGAAAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
955875289 3:63482805-63482827 ATGAATATGTACATGGATAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956867611 3:73384931-73384953 CTGCATAAACACAAGAACAAAGG + Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957514449 3:81232548-81232570 CTGTATAGCCACATGAACAAGGG - Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
962024812 3:131536800-131536822 CCCAGTATACACATGGACCATGG - Intronic
962514638 3:136139097-136139119 CTGACTATTTACAGGGACAAAGG - Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
965911373 3:173781609-173781631 TTGAATAGAGACATGGACACTGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967358394 3:188600119-188600141 ATGTACATACACATGGACATTGG + Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971224893 4:24742898-24742920 CTGAATGTACACGTGAACAGTGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973006782 4:45017600-45017622 GTGAACACACACTTGGACAAGGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974148255 4:57972721-57972743 TTGAATATACACATGGGCTGTGG + Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
975204916 4:71634501-71634523 GTGAGTGTACACTTGGACAACGG + Intergenic
976142371 4:82005765-82005787 CTGAATATACACATGCCAGAGGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977598185 4:98907053-98907075 CTGAATAAATACTTGGAGAATGG - Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979954457 4:126934996-126935018 CTGAATATGTACATCTACAATGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG + Intergenic
983107431 4:163706059-163706081 CTGAATATACACCTTCACAGTGG + Intronic
983458728 4:167999760-167999782 TTGATTATACACAGGGACCAGGG - Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
986980762 5:13446179-13446201 CTGATTTTTCACATGGGCAATGG - Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987654689 5:20791573-20791595 CTGAATAACCACGTGGAGAAGGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988740949 5:34070268-34070290 CTGAATAACCACGTGGAGAAGGG + Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG + Intronic
991936582 5:71808002-71808024 ATTAAAATACACATGGACATTGG + Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992623818 5:78618814-78618836 TTGAACATACACATTGAAAAAGG + Intronic
994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG + Intergenic
995243689 5:109913721-109913743 CTGCATATATCTATGGACAAGGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000459858 5:161501028-161501050 TTAAAAATACACATGGACACAGG - Intronic
1000469193 5:161618986-161619008 TCCAATATAAACATGGACAAAGG + Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004109876 6:12706977-12706999 TTGAATAGACACATTGCCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004850025 6:19689902-19689924 CTGAATATTAACATTGAAAATGG + Intergenic
1005536494 6:26762415-26762437 ATGCATGTACACATGCACAAAGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005801866 6:29433671-29433693 TTGAATATATACACAGACAAGGG + Intronic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1006699529 6:35960720-35960742 CTGCAGATACACATTTACAAAGG - Intronic
1007150062 6:39681376-39681398 ATGAAAATATACATGAACAAGGG - Intronic
1007705645 6:43789427-43789449 CTTAATATACACATGGCTAGTGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1010412331 6:75574663-75574685 TAGAATATAGACATGGGCAAAGG + Intergenic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011193627 6:84762208-84762230 CTAAATAAATACCTGGACAAGGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012774002 6:103479949-103479971 CTCAATATCCACAGGGAGAAAGG + Intergenic
1012948193 6:105490054-105490076 CTGAATGTACACATCTACATAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017292395 6:152754881-152754903 CTGAATAAAGACATTCACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018345794 6:162898003-162898025 GTGAATGTAGACATGGACAGGGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1023799768 7:43823754-43823776 GTGAATGCACACCTGGACAAGGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029701704 7:102250735-102250757 ACGCATATACACATAGACAAGGG - Exonic
1030729035 7:112962315-112962337 CTATATATACACATGCACAGTGG + Intergenic
1030928378 7:115487040-115487062 CTGAATAAACACATACACATAGG - Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031429173 7:121645291-121645313 TTGATTATAAACAAGGACAAGGG - Intergenic
1031845196 7:126797509-126797531 ATGAATATATTCATGGACCATGG - Intronic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036002093 8:4617813-4617835 ATGAATATACTCATGGAGGAGGG - Intronic
1036344178 8:7946186-7946208 ACGAATATATACATGGACATGGG + Intronic
1036839521 8:12106957-12106979 ACGAATATATACATGGACATGGG + Intronic
1036861311 8:12353198-12353220 ACGAATATATACATGGACATGGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039006106 8:33038850-33038872 GTGAATGCACACCTGGACAAGGG - Intergenic
1039229456 8:35427277-35427299 CTGAATGTTCACATGCACATAGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040606417 8:48936507-48936529 CTAAATATACACACTGACCATGG - Intergenic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041661497 8:60405753-60405775 CTGACTATAAACATTAACAAAGG + Intergenic
1042479709 8:69289721-69289743 CTGAACATACACAAAGAAAATGG - Intergenic
1042892893 8:73633012-73633034 CTGCTTATACACAGGGAAAAAGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1044851854 8:96436495-96436517 CTCAATATAGACATAGACATAGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1052784382 9:32815033-32815055 ATTAATATGCACATGGACACAGG - Intergenic
1053111272 9:35461732-35461754 GTGAATGCACACTTGGACAAGGG + Intergenic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056973974 9:91233606-91233628 CTGAATATACACATTGTTTATGG - Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060423809 9:123488176-123488198 TGGAGTAAACACATGGACAATGG + Intronic
1061379659 9:130246611-130246633 CTTAATACACACATACACAAAGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188839879 X:35003214-35003236 ATGAATATACTCATTGGCAATGG + Intergenic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193145959 X:78076006-78076028 GTGAGCATACACCTGGACAAGGG + Intronic
1193745756 X:85278329-85278351 CTTAATCTATACTTGGACAAAGG + Exonic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1195503147 X:105626554-105626576 TTAAATATAAACATGGTCAATGG + Intronic
1199644157 X:149889408-149889430 CTAAATCTACACATGGGCTAAGG - Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200781877 Y:7224108-7224130 ATGAATATAAACATGGAACATGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201854460 Y:18526145-18526167 CAGGATATAGGCATGGACAAAGG + Intergenic
1201878861 Y:18794240-18794262 CAGGATATAGGCATGGACAAAGG - Intronic