ID: 1018084899

View in Genome Browser
Species Human (GRCh38)
Location 6:160292399-160292421
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018084898_1018084899 16 Left 1018084898 6:160292360-160292382 CCTGAGGCACGGAAATATTTAGA No data
Right 1018084899 6:160292399-160292421 TCAACAATGCTGTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018084899 Original CRISPR TCAACAATGCTGTAAGTAAC TGG Intergenic