ID: 1018087922

View in Genome Browser
Species Human (GRCh38)
Location 6:160320982-160321004
Sequence GTTTAGGGATTCAGTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018087914_1018087922 16 Left 1018087914 6:160320943-160320965 CCTCCATGAACATTCAGGGGCCC No data
Right 1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG No data
1018087919_1018087922 -8 Left 1018087919 6:160320967-160320989 CCATCTTAGTAAAATGTTTAGGG No data
Right 1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG No data
1018087915_1018087922 13 Left 1018087915 6:160320946-160320968 CCATGAACATTCAGGGGCCCGCC No data
Right 1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG No data
1018087916_1018087922 -4 Left 1018087916 6:160320963-160320985 CCCGCCATCTTAGTAAAATGTTT No data
Right 1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG No data
1018087917_1018087922 -5 Left 1018087917 6:160320964-160320986 CCGCCATCTTAGTAAAATGTTTA No data
Right 1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018087922 Original CRISPR GTTTAGGGATTCAGTGGCCA AGG Intergenic
No off target data available for this crispr