ID: 1018088160

View in Genome Browser
Species Human (GRCh38)
Location 6:160322898-160322920
Sequence GAAAGCCGCCAGCAGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018088160_1018088165 7 Left 1018088160 6:160322898-160322920 CCACCCCTCTGCTGGCGGCTTTC No data
Right 1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG No data
1018088160_1018088164 -4 Left 1018088160 6:160322898-160322920 CCACCCCTCTGCTGGCGGCTTTC No data
Right 1018088164 6:160322917-160322939 TTTCACATGTTCTGTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018088160 Original CRISPR GAAAGCCGCCAGCAGAGGGG TGG (reversed) Intergenic
No off target data available for this crispr