ID: 1018088165

View in Genome Browser
Species Human (GRCh38)
Location 6:160322928-160322950
Sequence CTGTTGCCCTGGTCCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018088160_1018088165 7 Left 1018088160 6:160322898-160322920 CCACCCCTCTGCTGGCGGCTTTC No data
Right 1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG No data
1018088156_1018088165 23 Left 1018088156 6:160322882-160322904 CCTCTGTGCTCACAGCCCACCCC No data
Right 1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG No data
1018088161_1018088165 4 Left 1018088161 6:160322901-160322923 CCCCTCTGCTGGCGGCTTTCACA No data
Right 1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG No data
1018088163_1018088165 2 Left 1018088163 6:160322903-160322925 CCTCTGCTGGCGGCTTTCACATG No data
Right 1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG No data
1018088159_1018088165 8 Left 1018088159 6:160322897-160322919 CCCACCCCTCTGCTGGCGGCTTT No data
Right 1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG No data
1018088162_1018088165 3 Left 1018088162 6:160322902-160322924 CCCTCTGCTGGCGGCTTTCACAT No data
Right 1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018088165 Original CRISPR CTGTTGCCCTGGTCCCTCCT TGG Intergenic
No off target data available for this crispr