ID: 1018089599

View in Genome Browser
Species Human (GRCh38)
Location 6:160334168-160334190
Sequence AATTTCAACATGTCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018089597_1018089599 -9 Left 1018089597 6:160334154-160334176 CCCTTGGACACTTGAATTTCAAC No data
Right 1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG No data
1018089593_1018089599 12 Left 1018089593 6:160334133-160334155 CCAATGGCTCCCTCTGGGTGTCC No data
Right 1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG No data
1018089596_1018089599 2 Left 1018089596 6:160334143-160334165 CCTCTGGGTGTCCCTTGGACACT No data
Right 1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG No data
1018089590_1018089599 17 Left 1018089590 6:160334128-160334150 CCAACCCAATGGCTCCCTCTGGG No data
Right 1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG No data
1018089598_1018089599 -10 Left 1018089598 6:160334155-160334177 CCTTGGACACTTGAATTTCAACA No data
Right 1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG No data
1018089592_1018089599 13 Left 1018089592 6:160334132-160334154 CCCAATGGCTCCCTCTGGGTGTC No data
Right 1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG No data
1018089595_1018089599 3 Left 1018089595 6:160334142-160334164 CCCTCTGGGTGTCCCTTGGACAC No data
Right 1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018089599 Original CRISPR AATTTCAACATGTCTAAAAC TGG Intergenic
No off target data available for this crispr