ID: 1018092704

View in Genome Browser
Species Human (GRCh38)
Location 6:160358815-160358837
Sequence TGCAATTGGAAAGAAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 274}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018092704_1018092711 -1 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092711 6:160358837-160358859 AGTCTGAGCAGAGGGACGCTGGG No data
1018092704_1018092715 28 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092715 6:160358866-160358888 CCCTGGACTTTCCTAAAACCGGG 0: 1
1: 0
2: 0
3: 14
4: 107
1018092704_1018092710 -2 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG 0: 1
1: 0
2: 1
3: 12
4: 173
1018092704_1018092712 11 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092712 6:160358849-160358871 GGGACGCTGGGACAGAGCCCTGG No data
1018092704_1018092709 -9 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092709 6:160358829-160358851 CCAATTGCAGTCTGAGCAGAGGG No data
1018092704_1018092713 27 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092713 6:160358865-160358887 GCCCTGGACTTTCCTAAAACCGG 0: 1
1: 0
2: 0
3: 8
4: 104
1018092704_1018092707 -10 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092707 6:160358828-160358850 TCCAATTGCAGTCTGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018092704 Original CRISPR TGCAATTGGAAAGAAGTGTG GGG (reversed) Intronic
900685298 1:3944410-3944432 TGCAATCGGGAACAGGTGTGCGG - Intergenic
901206000 1:7496242-7496264 TGGAGAGGGAAAGAAGTGTGTGG + Intronic
902961494 1:19966352-19966374 TGCACTTGGATAGTAGGGTGTGG + Intergenic
903806513 1:26009564-26009586 TACTATTGAAAAGAAGTTTGTGG + Intergenic
904550683 1:31314661-31314683 TGCAATTGTACATAAATGTGTGG + Intronic
906293960 1:44637683-44637705 TGCACTTGCACAGCAGTGTGAGG + Intronic
907744445 1:57198852-57198874 GGAAAATGGAAGGAAGTGTGGGG + Intronic
908364765 1:63409519-63409541 TGAAATTCGATAGAAGTGTTGGG - Intronic
908518066 1:64913734-64913756 AGGAATTGAAAGGAAGTGTGTGG + Intronic
908805400 1:67925469-67925491 TGCAATTTGAATGAACTTTGTGG - Intergenic
910149168 1:84121460-84121482 TACGATTGGCAAGAAGTTTGGGG - Intronic
910309022 1:85802018-85802040 TGTAAATGGAAAGAAGTGGATGG - Intronic
912013975 1:105008181-105008203 TGCAATAGGAAATAAAGGTGAGG - Intergenic
914358600 1:146910415-146910437 AGCAAATGGAAAGATGTGTAAGG - Intergenic
916283361 1:163077305-163077327 TACAATGGGAAAGAAGGGTCAGG - Intergenic
916764845 1:167850381-167850403 GGCAATTGGAAATATGGGTGTGG + Intronic
916845011 1:168641779-168641801 TGAAATTGAAAAGAATTGGGTGG + Intergenic
916975384 1:170071930-170071952 TGCTATATGAAAAAAGTGTGTGG - Intronic
917451972 1:175154754-175154776 TGCAATGGGCAAGACTTGTGTGG + Intergenic
918676701 1:187295549-187295571 TGCCATTGGGAAGATGTTTGTGG + Intergenic
919026241 1:192174387-192174409 TGCATTTGAAAAGATGTGTTTGG + Intronic
921224604 1:213005791-213005813 TGAGATTGGAATGAAGTGAGGGG - Intronic
921400454 1:214716854-214716876 TGCAATATGAAAGATGTGTAGGG + Intergenic
922321878 1:224495723-224495745 TGCTATTGGAGAGAAGTGGCTGG + Intronic
923639218 1:235736583-235736605 TGTAATGGCAAAGAAGTCTGGGG + Intronic
923835865 1:237609959-237609981 GGCAATAGGAAAGCAGTTTGAGG + Intronic
923944159 1:238863903-238863925 TGCAATTTGACAGAAGAGTTTGG + Intergenic
1063100159 10:2943371-2943393 TGTAAAAAGAAAGAAGTGTGGGG - Intergenic
1065077561 10:22096942-22096964 TGCAACTGTAAAGAATTGTCAGG + Intergenic
1065379057 10:25070666-25070688 TGCAATTGGAAAAAGTAGTGTGG - Intergenic
1066208631 10:33214263-33214285 TGCAATTAGAAATAGGGGTGGGG - Intronic
1066342678 10:34551491-34551513 TGCAATTGGAATCAAAGGTGGGG - Intronic
1066742973 10:38577148-38577170 TGGAATTGAAATGAAGTGTCTGG + Intergenic
1066976574 10:42373968-42373990 TGCAATTTGAATGAACTCTGTGG - Intergenic
1069670948 10:70203365-70203387 TGCAATTAGCATGAAGTGTAAGG - Intronic
1070258098 10:74827223-74827245 TGCAATTTGAGAGAAGTGGAAGG + Intronic
1071022159 10:81070259-81070281 TGGAAATGGAAAGAAGTGAGTGG + Intergenic
1073663926 10:105508960-105508982 TGCTTAAGGAAAGAAGTGTGAGG - Intergenic
1075761841 10:124863434-124863456 TGCTGTTGGAAAGAAGCCTGGGG + Intergenic
1076630815 10:131851009-131851031 TGCAGGTGGAAAGGTGTGTGTGG - Intergenic
1076630825 10:131851063-131851085 TGCAGGTGGAAAGGTGTGTGTGG - Intergenic
1077893860 11:6439452-6439474 TACAATTGGAAAGAGATGTCTGG + Intronic
1079778636 11:24568130-24568152 TGCAATTGCAAAAAAGTATTAGG + Intronic
1079940565 11:26675061-26675083 TGCCCTTGGATAGAAGTTTGAGG - Intronic
1080099370 11:28441666-28441688 TGCAAATGGAATGAAGTGATGGG - Intergenic
1080776589 11:35392650-35392672 TGCCATTGGGAAAAAGAGTGTGG - Intronic
1081150758 11:39628092-39628114 TGCAATTGCAAAAAAGGGTGAGG - Intergenic
1082729978 11:56784188-56784210 TCCATTTGGAAAGAAATGTAAGG - Intergenic
1083601716 11:63952764-63952786 TGCAGTTGGAAAGCAAGGTGCGG + Exonic
1084940027 11:72607491-72607513 TGAAATTGGTAGGAAGTGGGTGG - Intronic
1085150531 11:74249368-74249390 TGCAATGGGAGAGAAGAGTTTGG + Intronic
1085411006 11:76290560-76290582 TGCATTTGTACACAAGTGTGCGG - Intergenic
1086665828 11:89480963-89480985 TGCTATTGGCAAAAAGTTTGTGG - Intronic
1087748074 11:101972450-101972472 TGCAATTGGGAAGAAGCATATGG - Intronic
1087906263 11:103701278-103701300 TGCAATTGCAAAGACATTTGGGG - Intergenic
1088117242 11:106326588-106326610 GGGAGTAGGAAAGAAGTGTGGGG + Intergenic
1088676002 11:112194031-112194053 TTCAAATGGAAAGAAATGTTAGG - Intronic
1089015821 11:115164439-115164461 TGCAATTAGGAAGAAGTGGCTGG - Intergenic
1090206924 11:124890040-124890062 TGCTACTGGAAAGAGGTGAGTGG - Intronic
1090532324 11:127604073-127604095 AGCAATTGGAAAAAAATTTGTGG - Intergenic
1092287218 12:7135641-7135663 TCCATTTGGGAAGAAGGGTGAGG - Intronic
1093558419 12:20507527-20507549 TGCAATTGGATATATGAGTGTGG - Intronic
1094096122 12:26706763-26706785 TGTAATAGGAATGAAGTTTGAGG - Intronic
1094318004 12:29153304-29153326 TGCTATTGGAAAGAAGCATAGGG + Intronic
1094826673 12:34274947-34274969 TGGAAATGGAGAGAAGTGTTTGG - Intergenic
1095608073 12:44094339-44094361 GGTAATTGGACAGAAGTGAGTGG + Intronic
1095709909 12:45277340-45277362 TACAATTGGGTAAAAGTGTGAGG - Intronic
1098655388 12:73022636-73022658 GGAAAATAGAAAGAAGTGTGTGG + Intergenic
1100067807 12:90671409-90671431 TTAAAATGGAAAGCAGTGTGTGG - Intergenic
1100478251 12:94953692-94953714 TGGAAGTGGAAAGGGGTGTGGGG - Intronic
1101074351 12:101112927-101112949 TGCAATTAGAAAGAAATGCCTGG - Intronic
1101140299 12:101789057-101789079 TTCAAATGGAAACAAGTCTGTGG + Intronic
1102022432 12:109693164-109693186 TTCATTTGTAAAGAAATGTGGGG - Intergenic
1103887448 12:124213413-124213435 TGGCATTGGGAAGAGGTGTGCGG + Intronic
1106014933 13:25859713-25859735 TGAACTTGGAAAGAATTTTGGGG - Intronic
1106769655 13:32949486-32949508 TGCTTTTGGAAAGAAGTTTTAGG + Intergenic
1106812363 13:33371980-33372002 ACCAATCAGAAAGAAGTGTGAGG + Intergenic
1107330970 13:39298825-39298847 TGCAATTAGGAAGAACTCTGGGG + Intergenic
1107703623 13:43075960-43075982 TACAAATGGAAAGAAGTAAGGGG - Intronic
1113744179 13:112731411-112731433 TGGAGTGGGAATGAAGTGTGTGG - Intronic
1114130874 14:19790369-19790391 AGCAAATGGAAAAAAGTGTAAGG - Intronic
1114464480 14:22911463-22911485 TGGAGTGGGAAAGAAATGTGTGG - Intronic
1114473645 14:22980213-22980235 TGTGATTGGAAAGAAGTGGCAGG - Intronic
1114701172 14:24680031-24680053 TGCAGGTGGAAAGGAGTGAGGGG - Intergenic
1115190613 14:30743865-30743887 TCAAAGTGGAAAGAAGTGTAGGG + Intergenic
1117183407 14:53215670-53215692 TGCAAGTGTAAAGATGTGTAAGG - Intergenic
1117250565 14:53933409-53933431 AGCAGCTGAAAAGAAGTGTGTGG + Intergenic
1117678897 14:58183225-58183247 TACAACTGAGAAGAAGTGTGTGG + Intronic
1119898120 14:78238046-78238068 TGAAATTGGAAGGAGGGGTGGGG + Intergenic
1120105179 14:80486056-80486078 TGCAATTAGCTAGAAGGGTGGGG + Intronic
1120961517 14:90129363-90129385 TGCAATTGTTCACAAGTGTGAGG + Intronic
1121520046 14:94579907-94579929 TTCAATGGGAATGAACTGTGAGG + Intronic
1121823374 14:96990056-96990078 TGCAATTGGAGATAAGGGGGTGG - Intergenic
1121887633 14:97559207-97559229 TGAAGTTGGAAAGAAGTGAATGG + Intergenic
1121922552 14:97896505-97896527 AGCCATTGGAAAGGAGAGTGGGG - Intergenic
1125697186 15:41648989-41649011 TGAAGGTGGAATGAAGTGTGTGG + Intronic
1126396956 15:48228332-48228354 TGCAAGTGGGAAGAAAAGTGGGG - Intronic
1128571423 15:68736252-68736274 TGAAGATGGAAAGAAGTGGGTGG - Intergenic
1129167824 15:73788753-73788775 TCCAATTGGCAAGAGGTGGGTGG - Intergenic
1129193772 15:73952531-73952553 TGCAATTGTAAGGGAGTGGGTGG - Intergenic
1130099665 15:80883034-80883056 AACAGTTGGAAACAAGTGTGAGG + Intronic
1130311652 15:82761238-82761260 TGTGATAGGAAAGCAGTGTGGGG + Intronic
1130623276 15:85486545-85486567 TGAAATTGATCAGAAGTGTGAGG + Intronic
1132262136 15:100434962-100434984 TGAAGTTGGAAAGGAGGGTGAGG - Intronic
1134094452 16:11410506-11410528 TGCAGTTGGAGCGAAGTTTGAGG + Intronic
1135890174 16:26349841-26349863 TGCATTTGTAAGAAAGTGTGAGG - Intergenic
1137012463 16:35336411-35336433 TCCAAATGGAAAGAATTCTGAGG - Intergenic
1141442194 16:84036774-84036796 TGCCATTGGGAAGCTGTGTGAGG - Exonic
1141588050 16:85048198-85048220 TGCACATGGAAAGATGGGTGAGG - Intronic
1143314539 17:6022366-6022388 GGAATTGGGAAAGAAGTGTGTGG - Intronic
1143609361 17:8008813-8008835 AGCATTTGGAAATAAATGTGGGG - Intronic
1143767650 17:9148151-9148173 TGCAACTGGAAAGCAGTTTTTGG + Intronic
1143891463 17:10105692-10105714 TGCGATTGGGAGGAAGTGGGTGG - Intronic
1144465952 17:15497709-15497731 TGTAATTGGAAAGAGGTAAGTGG + Intronic
1145092606 17:19998398-19998420 AGCAAGGGGAAAGAAGTGGGAGG + Intergenic
1147438302 17:40431421-40431443 TGCAGTTGGTAGGAAGTGGGTGG - Intergenic
1147796292 17:43045782-43045804 AGCAATTGGGCAGATGTGTGAGG - Exonic
1148037174 17:44673995-44674017 TGCAATTAAAGAGATGTGTGTGG + Exonic
1148554185 17:48568038-48568060 TGCAATTGGAAAGGGATGGGAGG - Intronic
1149622617 17:58057365-58057387 TACAATTAAAAAGAAGTTTGAGG - Intergenic
1150361584 17:64539795-64539817 TGCATTTGGAAAGTCCTGTGGGG + Intronic
1151062408 17:71111093-71111115 TTCTAATGGATAGAAGTGTGAGG - Intergenic
1151691842 17:75691437-75691459 TGGAGATGGAAAGGAGTGTGGGG - Intronic
1153098342 18:1435425-1435447 TGAAGTTGGAAAGAAGTAGGTGG - Intergenic
1153559610 18:6358763-6358785 TGCACGTGGAAAGCAGTGAGAGG + Intronic
1153690132 18:7584044-7584066 CGCAATGGGAAAGAACTGTTTGG + Intronic
1154075088 18:11192522-11192544 TGAAACTGGAAAGATGTGAGAGG - Intergenic
1154498101 18:14977277-14977299 TGCAATTTGAAAAGAGTGTGGGG - Intergenic
1156665449 18:39400359-39400381 TGAAAATGTATAGAAGTGTGTGG + Intergenic
1158857339 18:61555881-61555903 AGCAATGGAAAAGAAGTGTGAGG + Intergenic
1159145117 18:64444429-64444451 TGAAATAGGAAAGAAGGATGTGG + Intergenic
1159350211 18:67262385-67262407 TGCAATTTGAAAGAATGGTACGG + Intergenic
1160944174 19:1633489-1633511 TGCGATTTGAAAGAAGTTTCTGG - Intronic
1162176877 19:8836973-8836995 TGTATTTGTAAAGGAGTGTGTGG - Intronic
1165964340 19:39562964-39562986 TGCCTTTGGAAAGAGGAGTGTGG - Intergenic
1166456124 19:42941413-42941435 TGTAATTGGCCATAAGTGTGAGG + Intronic
925657509 2:6165670-6165692 TGGAATTGGAAAGAAGTCCTTGG - Intergenic
926487251 2:13477427-13477449 TGCAGTGGGACAGAAGTGTTTGG - Intergenic
927327187 2:21818668-21818690 TCCAATTGGAAAGAGCTGAGAGG - Intergenic
928069851 2:28203793-28203815 TGGGAATGGAAAGAAGAGTGTGG - Intronic
929268092 2:39941236-39941258 AGAAATTGGAAATAAGAGTGGGG - Intergenic
929311813 2:40434312-40434334 AGCAATTGGAAAGAACTCTCTGG + Intronic
929432446 2:41898556-41898578 CTCAATTGGAAAGGAGTGTGAGG + Intergenic
930410432 2:51018439-51018461 TATTATTGGAAAGAAGTGGGAGG - Intronic
930582294 2:53226730-53226752 TACAATTGGAAAGAAGACTTTGG - Intergenic
934909426 2:98237253-98237275 TGCTAACGGATAGAAGTGTGGGG + Intronic
937797820 2:126045836-126045858 TACAAATGGAATGGAGTGTGTGG - Intergenic
938001307 2:127741274-127741296 TGAAAATGGAAAGAAGTGGAGGG + Intronic
938619324 2:133032373-133032395 TGGATTTGGAAAGAAGAGGGAGG + Intronic
941212330 2:162656135-162656157 TGAAATTTGAAAGATCTGTGTGG + Intronic
941212965 2:162666238-162666260 TGGAAGTGAACAGAAGTGTGAGG - Intronic
943989370 2:194667786-194667808 TGTACTTGGAAAGAATTGTTGGG - Intergenic
944852871 2:203737939-203737961 TGCTATTTAAAAGAGGTGTGGGG + Exonic
945601837 2:211877275-211877297 AGCAATTAGACAGAACTGTGGGG + Intronic
947802036 2:232935235-232935257 TGGAATTGGAAGGAAGTGGATGG + Intronic
948705266 2:239787949-239787971 TGCAATTGGAAAGGCCAGTGTGG + Intronic
1168741533 20:195702-195724 TACAAATGGAAAGAGCTGTGGGG - Intergenic
1169484139 20:6012417-6012439 TGGAGTTGGAGAGAAGTGTGTGG + Intronic
1169688107 20:8299824-8299846 TGAAAATGGAGAGAAGTGGGTGG - Intronic
1169748665 20:8968902-8968924 TGGAGTTGGAATGAGGTGTGAGG - Intergenic
1170239573 20:14148920-14148942 TGCCAGTGGTAAGAAGTATGAGG + Intronic
1170248675 20:14254727-14254749 TGGAATTAAAAAGAAGTGTAAGG + Intronic
1176749542 21:10680014-10680036 TGGAATTGAAAAGAAGTGAGTGG - Intergenic
1176749611 21:10680494-10680516 TGGAATTGAAAAGAAGTCAGAGG - Intergenic
1176923255 21:14715615-14715637 TGCAAGTGGAATGAAGGATGTGG - Intergenic
1178214527 21:30579253-30579275 TGCAAATGTAGATAAGTGTGTGG + Intergenic
1179017960 21:37610043-37610065 TGCTGTTGGAGACAAGTGTGTGG + Exonic
1179099889 21:38347228-38347250 TGGAATTGGAAAGAAGTGGATGG + Intergenic
1179180608 21:39041786-39041808 GACAAATGGAAAGAGGTGTGGGG + Intergenic
1180227352 21:46402701-46402723 TGCAATCAGAAAGCAGTTTGGGG - Intronic
1180532202 22:16358625-16358647 TGGAATTGAAACGAAGTGTCTGG + Intergenic
1180532217 22:16358725-16358747 TGGAATTGAAACGAAGTGTCTGG + Intergenic
1203317426 22_KI270737v1_random:27067-27089 TGGAATTGAAACGAAGTGTCTGG - Intergenic
1203317441 22_KI270737v1_random:27167-27189 TGGAATTGAAACGAAGTGTCTGG - Intergenic
951495463 3:23320408-23320430 TTCAATTTGAATGAAGTGTATGG - Intronic
952332350 3:32375708-32375730 TGCAATAGGAAAGCTGAGTGTGG + Intergenic
953225530 3:41015922-41015944 TGCCAATGGATTGAAGTGTGAGG + Intergenic
953418327 3:42735625-42735647 GGCAAGTGGAAAGAAGTGGAAGG + Intronic
955245456 3:57220774-57220796 AGCAATTTGAAACAAGTGTTGGG - Intronic
957369104 3:79268356-79268378 TGAAATTGAAAAAAAGTTTGAGG - Intronic
957836906 3:85606304-85606326 AGCATGTGGAAAGCAGTGTGGGG - Intronic
958927432 3:100174087-100174109 TGTAACTGGAAAGAAATTTGAGG + Intronic
959660636 3:108864138-108864160 TACAATTTGAAAGATGTTTGGGG - Intergenic
960314868 3:116164202-116164224 TGCAGTTAGAAAGAAGTGTCTGG + Intronic
961104583 3:124230258-124230280 TGCAGAGGGAAAGAAGTGTCAGG - Intronic
963129431 3:141844768-141844790 TGTGATTGGGAAGGAGTGTGAGG - Intergenic
963755880 3:149234838-149234860 AACAATTGTAAAGAAGTATGGGG + Intergenic
964383557 3:156123265-156123287 TGCTATTGGAAATAATTCTGTGG + Intronic
965678838 3:171229847-171229869 GGAAAGTGGAAATAAGTGTGAGG - Intronic
966629906 3:182060688-182060710 TCCCATTGGAAAGAAGTCTTGGG - Intergenic
966712917 3:182987769-182987791 TTCAATTGGAAAAAAGCATGTGG + Intergenic
967666100 3:192174044-192174066 TGCAGTAGGAAAGCAATGTGTGG - Intronic
967763396 3:193250845-193250867 TCCAATTGGAAAAAGGTGCGGGG - Intronic
969607201 4:8208336-8208358 TTCAAATGGAAAGAAGTATGTGG - Intronic
975676576 4:76833163-76833185 TGCAATTGGAAAGAGGATAGTGG - Intergenic
976863984 4:89702201-89702223 TGCATTTGGACAGAAGCCTGTGG + Intergenic
977007834 4:91593936-91593958 TGCTATTGTAAAGAAATGAGAGG + Intronic
977734030 4:100390533-100390555 AGCTATTGGAAAGAAGTCTCAGG + Intergenic
978708076 4:111741149-111741171 TGCAATGAGAAAGAAGAGAGTGG - Intergenic
980899336 4:138889556-138889578 TGTGCTTGGAAAGAAGAGTGAGG - Intergenic
981540483 4:145841601-145841623 TGCAAGTGTAAAGAAGGCTGTGG - Intronic
982929857 4:161391021-161391043 TGCAAATGAAAAGTAGTGAGGGG + Intronic
983238965 4:165209458-165209480 TGCAGGTGAAAAGAAGGGTGTGG + Intronic
988888802 5:35590642-35590664 TGTAATTGAAATAAAGTGTGAGG + Intergenic
989713466 5:44429881-44429903 TGCAACTGGAAACTAGAGTGAGG + Intergenic
990004622 5:50931667-50931689 TGAACTTGGAAAAAAGTCTGAGG + Intergenic
990849788 5:60189853-60189875 TGCAAAGGGAAAGAATTGTTTGG + Intronic
991464305 5:66894062-66894084 TGCAAGTGGGAAGCAGTGTGAGG - Intronic
992424320 5:76640513-76640535 AGAAATGGGAAAGAAGTCTGAGG + Intronic
993747198 5:91615215-91615237 TGCAAATGGAGAGAAGAGTTTGG - Intergenic
994043053 5:95279522-95279544 TGCTATTACAAATAAGTGTGTGG - Intronic
995721102 5:115133985-115134007 TGGAATGAGATAGAAGTGTGTGG - Exonic
995817050 5:116182391-116182413 TGAAATGGGGAAGAGGTGTGGGG + Intronic
995997229 5:118316106-118316128 TGGAATTGAAAAGTATTGTGTGG + Intergenic
996261921 5:121482030-121482052 TGCAGTCTGAGAGAAGTGTGAGG + Intergenic
997050033 5:130369333-130369355 AGCAAATGGAAAGAAATCTGAGG + Intergenic
998587762 5:143446192-143446214 TGCCATGGGAAACAAGTATGGGG + Intergenic
1002692898 5:181062982-181063004 GGCATTTTGAAAGAGGTGTGTGG + Intergenic
1002878851 6:1234656-1234678 TGCAAATGGAAGGAAGTATATGG - Intergenic
1003266992 6:4574639-4574661 TGAAACTGGCAAGAAGTGAGAGG + Intergenic
1005405969 6:25488386-25488408 TGCAATTTGATGGAAGTGTTGGG + Intronic
1006460762 6:34156449-34156471 TGCAAATGTCAAGGAGTGTGTGG + Intergenic
1007964156 6:45988204-45988226 AGAAATTGGAAAGAAGAGAGGGG + Intronic
1008145804 6:47890284-47890306 TGCAATTGTCAAGAAGTTTTAGG - Intronic
1009595756 6:65733745-65733767 TGCAATTGGAAAGAAATTGGTGG + Intergenic
1010193271 6:73214774-73214796 TGCAACAGGAAAGGCGTGTGTGG - Intronic
1010377600 6:75190156-75190178 TGTACTTGTAAAGAAGAGTGAGG - Intronic
1011668936 6:89663512-89663534 TCCAATTGGACAGAAATTTGGGG + Intronic
1012523875 6:100153928-100153950 TGCAAATGGAAAGCAGTGGCAGG + Intergenic
1013572923 6:111448192-111448214 GGCAAATGGGAAGAACTGTGTGG + Intronic
1014739798 6:125135776-125135798 TGAAAATGGAAAGAAGTGGAGGG - Intronic
1014753497 6:125278798-125278820 TGAAAATGGAAAGAAGTGGTAGG + Intronic
1016781707 6:147966513-147966535 TGGACTTGTAAAGAAGTTTGAGG + Intergenic
1018092704 6:160358815-160358837 TGCAATTGGAAAGAAGTGTGGGG - Intronic
1019634976 7:2070647-2070669 TTCCTTTGGAAAGAAGTTTGTGG - Intronic
1020734202 7:11926328-11926350 TGCAATTGGCCAGAAAGGTGAGG - Intergenic
1021391515 7:20098937-20098959 TGAAATTGTATAGAAATGTGAGG + Intergenic
1021801732 7:24314040-24314062 TGCAATTACAAAGAAGAATGAGG + Intergenic
1021831031 7:24609766-24609788 TGTCTTTGGAAAGAAGTTTGTGG + Intronic
1023566087 7:41525018-41525040 GACAACTGGAAACAAGTGTGGGG - Intergenic
1025014380 7:55427096-55427118 TGCAAAGGGAAGGAAATGTGTGG + Intronic
1027709160 7:81575853-81575875 AATAATTGGAAAGAAGGGTGAGG - Intergenic
1030839772 7:114334167-114334189 TTCAATAGAAAAGAAATGTGCGG + Intronic
1031108810 7:117580873-117580895 TTCAATTAGCAACAAGTGTGGGG + Intronic
1031563178 7:123262844-123262866 TGGAATTGGAAAGAAGGGGAGGG - Intergenic
1034731575 7:153391821-153391843 AGGAAGTGGGAAGAAGTGTGAGG - Intergenic
1035308123 7:157946476-157946498 TGCATCTGGAAACAAGTGAGAGG + Intronic
1037048244 8:14336927-14336949 AACAATTGAAAACAAGTGTGTGG - Intronic
1038336898 8:26652895-26652917 TGCAATTGGAAAGAAAGTTTGGG + Intronic
1039650264 8:39333910-39333932 TTCACTTGGACAGCAGTGTGGGG - Intergenic
1040683914 8:49847306-49847328 TGCAACTTCAAAGAACTGTGTGG + Intergenic
1041534544 8:58911381-58911403 TGGAATTGGAATAAAGTTTGGGG - Intronic
1044278036 8:90324651-90324673 GGGAATTTGACAGAAGTGTGAGG + Intergenic
1047010460 8:120667369-120667391 TGGAAATGGAGAGAAGTGTTTGG + Intronic
1047276979 8:123413253-123413275 GGCATTTGGAAAGAAGAATGAGG - Intronic
1047791806 8:128210971-128210993 TGCTATTTGAAAGGAGTGAGGGG - Intergenic
1050730517 9:8704076-8704098 TGGAATTGGAGAGAAGTGGATGG - Intronic
1053092906 9:35295982-35296004 TGCAATTGGCAAGAAGAATTTGG + Intronic
1055772525 9:79732579-79732601 TGGAATTGAAAAGGAGTTTGTGG + Intergenic
1056273975 9:84974918-84974940 TGCAAAAGGAAAGAACAGTGTGG + Intronic
1056374422 9:85992774-85992796 TGAAACTTGAATGAAGTGTGAGG + Intronic
1057029093 9:91760044-91760066 TCCAGTGGGGAAGAAGTGTGGGG - Intronic
1059845361 9:118269624-118269646 TGCAATGGGAAAGAAGGCTCAGG - Intergenic
1185845045 X:3430130-3430152 TCCAAATGGAAAGAAGAATGTGG - Intergenic
1186998949 X:15155507-15155529 TGAAATTAGAAAGAAATATGTGG + Intergenic
1187031109 X:15489531-15489553 AACAATTGGAAAGAATTTTGGGG - Intronic
1187414001 X:19076330-19076352 TCCAAATGGCAAGAAGTCTGTGG - Intronic
1187482518 X:19670929-19670951 TGCTGTTGGAAGGAAGTGGGAGG - Intronic
1187532735 X:20111493-20111515 TGCAATTGCCTAGAAGTCTGTGG - Intronic
1188241263 X:27794503-27794525 TGCAACTGGAAGGAGGTGTGTGG + Intergenic
1189300857 X:39951363-39951385 TGCAAGGGGAGAGAAGGGTGGGG - Intergenic
1190380584 X:49836763-49836785 TGGAAGTGGAAAGAAGCCTGTGG - Intergenic
1190385201 X:49878318-49878340 TGGAAGTGGAAAGAAGCCTGTGG - Intergenic
1190924211 X:54887379-54887401 TGGATTTGGAGAGGAGTGTGGGG + Intergenic
1191131746 X:57020850-57020872 TGCAACTGGAAAGAAGAGGCAGG - Intergenic
1191977096 X:66885229-66885251 AGCAAATGGGAAGAAGTGAGGGG + Intergenic
1192306935 X:69970897-69970919 TGTAATTAGAAAGAAATCTGAGG + Intronic
1192491458 X:71579690-71579712 AGAAGTTGGATAGAAGTGTGGGG + Intronic
1193848459 X:86504835-86504857 TGAAAAAGGAAAGAGGTGTGGGG + Intronic
1194742610 X:97592709-97592731 TCCAATTGGAAAGACATTTGGGG + Intronic
1195343991 X:103930225-103930247 TGCAGGTGGAAAGAATAGTGTGG - Intronic
1195363009 X:104103286-104103308 TGCAGGTGGAAAGAATAGTGTGG + Exonic
1196042343 X:111218553-111218575 TTCAAATGGAAGGAAGTGTTAGG + Intronic
1196128527 X:112126190-112126212 TTCAATTGCAAATATGTGTGAGG - Intergenic
1196929606 X:120668460-120668482 TGCCCTTGGAAAGAGGTATGAGG - Intergenic
1197237339 X:124082243-124082265 TGCAGATGGAAAGAAGGGTGTGG - Intronic
1199352849 X:146824045-146824067 GGGAATTGGGAAGAAGTGGGAGG - Intergenic
1200225791 X:154416704-154416726 TGCAAAGGGAAAGCAGTGCGGGG + Intronic
1200819372 Y:7566563-7566585 TCCAAATGGAAAGAAGAATGTGG + Intergenic