ID: 1018092705

View in Genome Browser
Species Human (GRCh38)
Location 6:160358816-160358838
Sequence CTGCAATTGGAAAGAAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018092705_1018092713 26 Left 1018092705 6:160358816-160358838 CCCACACTTCTTTCCAATTGCAG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1018092713 6:160358865-160358887 GCCCTGGACTTTCCTAAAACCGG 0: 1
1: 0
2: 0
3: 8
4: 104
1018092705_1018092711 -2 Left 1018092705 6:160358816-160358838 CCCACACTTCTTTCCAATTGCAG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1018092711 6:160358837-160358859 AGTCTGAGCAGAGGGACGCTGGG No data
1018092705_1018092709 -10 Left 1018092705 6:160358816-160358838 CCCACACTTCTTTCCAATTGCAG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1018092709 6:160358829-160358851 CCAATTGCAGTCTGAGCAGAGGG No data
1018092705_1018092712 10 Left 1018092705 6:160358816-160358838 CCCACACTTCTTTCCAATTGCAG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1018092712 6:160358849-160358871 GGGACGCTGGGACAGAGCCCTGG No data
1018092705_1018092715 27 Left 1018092705 6:160358816-160358838 CCCACACTTCTTTCCAATTGCAG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1018092715 6:160358866-160358888 CCCTGGACTTTCCTAAAACCGGG 0: 1
1: 0
2: 0
3: 14
4: 107
1018092705_1018092710 -3 Left 1018092705 6:160358816-160358838 CCCACACTTCTTTCCAATTGCAG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG 0: 1
1: 0
2: 1
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018092705 Original CRISPR CTGCAATTGGAAAGAAGTGT GGG (reversed) Intronic
900125707 1:1068188-1068210 CTGCAGTTGGAGAGGTGTGTGGG - Intergenic
903312017 1:22465954-22465976 CTGGAATTGGAAAGTGGTGATGG - Intronic
905928755 1:41771469-41771491 CTGCAATGGGAAAGCAGTTTAGG + Intronic
906373345 1:45273378-45273400 CTGCCTTTGAAAAAAAGTGTTGG + Intronic
908097339 1:60752682-60752704 CTGGAATTGGAAAGATGAGATGG - Intergenic
908364766 1:63409520-63409542 ATGAAATTCGATAGAAGTGTTGG - Intronic
908901009 1:68956454-68956476 CTGCAATTAGAAGCAAGGGTAGG - Intergenic
909469068 1:76006306-76006328 CCACAATTGGAAAGAAGTCAAGG - Intergenic
909638523 1:77846062-77846084 CTGAAATTAGAAAGTAGTGCTGG - Intronic
910149169 1:84121461-84121483 CTACGATTGGCAAGAAGTTTGGG - Intronic
912662423 1:111544319-111544341 CTGGAATTGGATAGTAGTGATGG - Intronic
917239137 1:172928553-172928575 TTGCCATTGGCAAGAAGAGTTGG - Intergenic
919532009 1:198733697-198733719 CTGAAATGGCAAAGAAGTCTAGG + Intronic
921183587 1:212651528-212651550 CTCCAATAGGAAAGAGGAGTTGG - Intergenic
921274549 1:213506023-213506045 CTCCAGCTGGATAGAAGTGTGGG - Intergenic
921400453 1:214716853-214716875 ATGCAATATGAAAGATGTGTAGG + Intergenic
921730095 1:218568240-218568262 CAGAAAGTGGAGAGAAGTGTGGG - Intergenic
922406349 1:225317538-225317560 CTGCATTTGGCAAGATGTTTTGG - Intronic
1063373646 10:5538567-5538589 TTGTATTTGGAAAGAAGTGGCGG - Intergenic
1063569507 10:7201918-7201940 TTCCATTTGAAAAGAAGTGTAGG - Intronic
1063807190 10:9658936-9658958 CTGCAATTGGCAGTTAGTGTTGG - Intergenic
1064669382 10:17694509-17694531 CTGCACTTGGGAAGTAGTGGTGG + Intronic
1065352410 10:24807312-24807334 CTGGAATTTGGAAGAAGAGTTGG - Intergenic
1068109828 10:52666812-52666834 CTGCATTTGGAAAGAGAGGTTGG + Intergenic
1069646879 10:70006478-70006500 CCTCAATTGGAAAAAAATGTTGG + Intergenic
1074748101 10:116555416-116555438 CTCCATTTGGAAAGAAATCTAGG - Exonic
1075136614 10:119792065-119792087 TTGCACTTGGGAAGAAGTGATGG + Intronic
1075761840 10:124863433-124863455 CTGCTGTTGGAAAGAAGCCTGGG + Intergenic
1077425688 11:2475078-2475100 CAGGAATTAGAAAGACGTGTCGG - Intronic
1078026217 11:7698113-7698135 CTGCAACTGGAAGGAGGAGTAGG - Intronic
1078253326 11:9636443-9636465 CTGGACTTTGAAAGACGTGTTGG - Intergenic
1079457472 11:20649517-20649539 GTGCAACTGGAAATGAGTGTCGG + Intronic
1080099371 11:28441667-28441689 ATGCAAATGGAATGAAGTGATGG - Intergenic
1080883221 11:36341925-36341947 CTGGAAGCGGAAAGAAATGTTGG + Intronic
1083075093 11:60028601-60028623 CTGGAACTGGAAAGAAGGGAAGG - Intergenic
1085398721 11:76221993-76222015 CTGAAATTAGAAAGTAGTGATGG - Intergenic
1086275783 11:85127009-85127031 ATGAAATGGGAAAGAAGTCTGGG + Intronic
1087352422 11:97048978-97049000 TCGCAATTTCAAAGAAGTGTTGG + Intergenic
1089035378 11:115384326-115384348 CTGCAAATGGAGAAAAGAGTTGG - Intronic
1091112935 11:132987414-132987436 CTGCAATATGAAAGAAGAGATGG + Intronic
1091267516 11:134282421-134282443 CTGCATGGGGAAAGAAGAGTGGG - Intronic
1091855030 12:3732573-3732595 CCGCAGTGGGCAAGAAGTGTGGG - Intronic
1092529796 12:9334937-9334959 CTGCAAGAGGAAAGAAGTCAAGG + Intergenic
1092791820 12:12076848-12076870 CTGCTATTGGAAGGAGGTGTAGG - Intronic
1094159406 12:27373762-27373784 CTGCATTTTGAATGAAATGTAGG - Intronic
1094318003 12:29153303-29153325 TTGCTATTGGAAAGAAGCATAGG + Intronic
1094368513 12:29709905-29709927 CTGCGATTGGAAAGCACTTTAGG - Intronic
1096235392 12:49922841-49922863 CTCCAAGTGGAGAGAACTGTGGG + Intergenic
1096417018 12:51423554-51423576 CTGAAATTGGAAACAAGGTTGGG - Intronic
1098165986 12:67698467-67698489 GTGCATGTTGAAAGAAGTGTTGG + Intergenic
1098227669 12:68341286-68341308 CTGCAATTGGAATTAATTTTAGG - Intergenic
1099837427 12:87924482-87924504 TACCAATAGGAAAGAAGTGTTGG - Intergenic
1100478252 12:94953693-94953715 CTGGAAGTGGAAAGGGGTGTGGG - Intronic
1101869548 12:108553576-108553598 GTGTAATTTGAATGAAGTGTAGG - Intronic
1102022433 12:109693165-109693187 CTTCATTTGTAAAGAAATGTGGG - Intergenic
1102108998 12:110349779-110349801 CTGCAGTTAGCAAGAAGGGTAGG + Intronic
1103004081 12:117407861-117407883 CTGCAGTTGGCAAGACCTGTGGG - Intronic
1103178041 12:118881493-118881515 CTGGAATTGGATAGCAGTGATGG - Intergenic
1106014934 13:25859714-25859736 CTGAACTTGGAAAGAATTTTGGG - Intronic
1106109781 13:26766724-26766746 CAGCAATGGGAAAGGAATGTAGG + Intergenic
1107597833 13:41981503-41981525 CTGGAATTGGATAGAGGTGATGG + Intergenic
1108461206 13:50669255-50669277 CTGCAATTGGCAAGAACACTGGG - Intronic
1111340835 13:86883206-86883228 CTGCAATTGGACAGATGAGATGG - Intergenic
1112259910 13:97868622-97868644 TTGCAAATGGAAAGAAGTAGAGG + Intergenic
1112286755 13:98111545-98111567 CTGCAGGTGGACACAAGTGTAGG + Intergenic
1113554821 13:111224313-111224335 CTGTGATTGGATAGAAGTGGAGG + Intronic
1114701173 14:24680032-24680054 CTGCAGGTGGAAAGGAGTGAGGG - Intergenic
1115190612 14:30743864-30743886 CTCAAAGTGGAAAGAAGTGTAGG + Intergenic
1116427739 14:44810817-44810839 CAGCATTTGGGAAGAAGAGTTGG - Intergenic
1117581928 14:57160060-57160082 GTGCAATTTTAAAGCAGTGTTGG + Intergenic
1118775678 14:68972581-68972603 CTGGAATTGGATAGTAGTGGTGG - Intronic
1120249648 14:82047625-82047647 CTGAAATTAGAAAGATGTGTAGG - Intergenic
1120806692 14:88759059-88759081 CTGAAATTAGATAGAAGTGATGG + Intronic
1121331978 14:93055462-93055484 CTGAAAACAGAAAGAAGTGTGGG - Intronic
1121945915 14:98121778-98121800 CTAGAACTGGAGAGAAGTGTAGG + Intergenic
1122224731 14:100267867-100267889 CTGTAATTGGACAGTGGTGTTGG + Intronic
1123120198 14:105912860-105912882 AGGCAATTGGCAAGAGGTGTTGG + Intergenic
1124090319 15:26593392-26593414 CTGGAAATGGATAGTAGTGTTGG - Intronic
1125919976 15:43519568-43519590 CTGCAATTGGAAAGGGGATTTGG + Intronic
1126354893 15:47784643-47784665 CTGCATTTTGAAAGAAGTCTAGG - Intergenic
1128140241 15:65294766-65294788 CTGAAAATGGAAAGTAGTGATGG + Intronic
1128870301 15:71150079-71150101 CGCCACTTGGAAAGGAGTGTGGG + Intronic
1129190326 15:73933775-73933797 CAGCAATTGGAAGGAGGTGTGGG - Intronic
1129533091 15:76285253-76285275 TTCCAAGTGGAAAGAAGGGTAGG + Intronic
1130852545 15:87809965-87809987 CTGTAATTTGGAAGGAGTGTTGG - Intergenic
1131994592 15:98121941-98121963 CTCAAATTGGAAAGGACTGTAGG - Intergenic
1134139856 16:11708855-11708877 CTGACTTTGGAAAGAAGAGTGGG - Intronic
1134915152 16:18063081-18063103 CTTTAATTACAAAGAAGTGTTGG - Intergenic
1135146818 16:19969801-19969823 CTTGACTTGGAAAGATGTGTGGG - Intergenic
1138022443 16:53496877-53496899 CTGCAATGTGAGACAAGTGTAGG - Intronic
1143476031 17:7204502-7204524 CTGCATGTGGAAGGAGGTGTAGG + Intronic
1143717944 17:8788439-8788461 ATAAAGTTGGAAAGAAGTGTTGG - Intergenic
1144385736 17:14747554-14747576 CTGCAATTGGCAAGGTGTCTGGG - Intergenic
1148963784 17:51417197-51417219 CTGGAAATAGAATGAAGTGTTGG + Intergenic
1151691843 17:75691438-75691460 CTGGAGATGGAAAGGAGTGTGGG - Intronic
1154281462 18:13006942-13006964 CTGGAGTGGGAAAGAAGGGTGGG + Intronic
1154498102 18:14977278-14977300 GTGCAATTTGAAAAGAGTGTGGG - Intergenic
1157993977 18:52532870-52532892 CTGCAATTAGATAGCAGTGATGG - Intronic
1158119279 18:54030469-54030491 CTGCAAATGGAAAGCAGAGTGGG + Intergenic
1158683106 18:59586613-59586635 CTGCGATGGGAAAGAAAAGTTGG + Intronic
1159527547 18:69612557-69612579 CTGAAAATGGAAGGAAATGTAGG - Intronic
1164418968 19:28070858-28070880 CTGCAAATGGAAAGAACCATTGG + Intergenic
1164957166 19:32396405-32396427 ATGGAAATGGAAAAAAGTGTAGG + Intergenic
1166978425 19:46618722-46618744 CTGGAATTGGATAGTAGTGAGGG - Intergenic
925383393 2:3444447-3444469 CTGACATTGGGAAGAAATGTGGG + Intronic
926647290 2:15303439-15303461 CACCAAGTGGAAAGAACTGTAGG + Intronic
927478910 2:23434935-23434957 CTGGAAGTGGGAAGAAGGGTTGG + Intronic
930351984 2:50268237-50268259 CTGGCATTTGAAAGAAGAGTTGG + Intronic
932102756 2:68915573-68915595 CTGCATATGGAAGGAAGTGAAGG + Intergenic
936734498 2:115425126-115425148 CTGCAATTGGGTAGAGGTGCTGG + Intronic
937034257 2:118767820-118767842 CCTCCATTGGAAAGAAGTGAAGG - Intergenic
938001306 2:127741273-127741295 CTGAAAATGGAAAGAAGTGGAGG + Intronic
940246844 2:151628292-151628314 CTGGATTTGGGAAGGAGTGTGGG - Intronic
940996712 2:160157705-160157727 CTACATTTTGAAAGAAATGTAGG + Intronic
941732651 2:168935366-168935388 CTGGAATTGGAAAGGAGAGGCGG - Exonic
942855777 2:180545792-180545814 CAGCAATTTGAAAGAAGATTTGG + Intergenic
942884986 2:180912312-180912334 CTACAATAGAAAAGAATTGTAGG + Intergenic
942903485 2:181152342-181152364 TTGCAATCTGGAAGAAGTGTGGG - Intergenic
943989371 2:194667787-194667809 GTGTACTTGGAAAGAATTGTTGG - Intergenic
944825654 2:203480686-203480708 TTACAACTGGAAAGAAGTGGAGG + Intronic
945176122 2:207045208-207045230 TTGCAACTGGAAATGAGTGTAGG - Intergenic
946299404 2:218813378-218813400 CTGCAATTTGAATGGAGAGTTGG + Intronic
1169265829 20:4166936-4166958 ATGTAATTGGAAAGAAGTCTGGG + Intronic
1177668073 21:24187774-24187796 TTGCAATGAGAAAGAGGTGTGGG - Intergenic
1178639874 21:34337273-34337295 CTGGAATTGGGAAGAAGCTTTGG + Intergenic
1180227353 21:46402702-46402724 CTGCAATCAGAAAGCAGTTTGGG - Intronic
1181874954 22:25933169-25933191 CTGAAATTGGAAAGAAATAGGGG - Intronic
950127671 3:10520143-10520165 CTGGAATTGAAGAGAGGTGTCGG + Intronic
951093707 3:18603857-18603879 GTGCTATTGAAAAGTAGTGTAGG - Intergenic
955245457 3:57220775-57220797 CAGCAATTTGAAACAAGTGTTGG - Intronic
955533262 3:59897042-59897064 CTGCAGTTGGAAAGGTGGGTGGG - Intronic
956937516 3:74120256-74120278 CTGCCTTTGGAATGAAGTTTGGG - Intergenic
957618494 3:82565185-82565207 CTGCTAGTGGATGGAAGTGTTGG - Intergenic
958177946 3:90020956-90020978 CAGCATTTGGAAAGAACAGTTGG + Intergenic
959168187 3:102807219-102807241 CTGAAATTGGAGAGAGGTTTCGG + Intergenic
959234602 3:103703541-103703563 CTACAATTGCAAAGAAAAGTGGG - Intergenic
959900034 3:111650605-111650627 CTGGAATTAGAAAGTAGGGTTGG - Exonic
959957357 3:112253396-112253418 CTGCAACTGTAAGGAAATGTAGG + Intronic
965715342 3:171596634-171596656 ATGCAATTGGGTGGAAGTGTAGG - Intergenic
966629907 3:182060689-182060711 TTCCCATTGGAAAGAAGTCTTGG - Intergenic
966931645 3:184679227-184679249 CTGCAGCTGGAAAGAGGGGTTGG - Intronic
967763397 3:193250846-193250868 CTCCAATTGGAAAAAGGTGCGGG - Intronic
971742299 4:30536054-30536076 CTGCAATAAGAAATAACTGTAGG - Intergenic
972577870 4:40368602-40368624 CTGCAATTGACATGAATTGTTGG - Intergenic
974358879 4:60849678-60849700 ATGGAATTGGAAATAAGGGTAGG + Intergenic
978155308 4:105483168-105483190 CTAAAATTGGAAAGAAGTAAAGG + Intergenic
979312309 4:119217714-119217736 TTGCAATTTTAAATAAGTGTAGG + Intronic
982389599 4:154849908-154849930 CTGCAAGTGGTAATCAGTGTTGG + Intergenic
982444863 4:155478578-155478600 GGGCAATTGGAAAGAAATGCTGG + Intergenic
984389725 4:179113626-179113648 CTGCAGATGGAAAGAAAAGTGGG - Intergenic
984395407 4:179191755-179191777 ATGTAATGGGAATGAAGTGTTGG - Intergenic
985391199 4:189492084-189492106 CTGCAATTGGAAGTGAATGTCGG - Intergenic
987506037 5:18774096-18774118 CTGCAATCTAAAAGATGTGTGGG - Intergenic
989666532 5:43860311-43860333 CTCCAGTTAGAAACAAGTGTTGG - Intergenic
990875216 5:60476631-60476653 CTTCCAATGGAAAGAAGGGTAGG - Intronic
992749618 5:79849990-79850012 CTGCACGTAGAAAGAAGGGTGGG + Intergenic
992853229 5:80832634-80832656 CTGTAAATGGAAAGTAGTGATGG + Intronic
992853370 5:80834382-80834404 CTACAAATGGAAAGCAGTGATGG + Intronic
994038750 5:95233130-95233152 GTGCACTTGAAAAGAAGTGTTGG - Intronic
994827293 5:104730652-104730674 TTGAAATTGGAAAGTACTGTGGG - Intergenic
995817049 5:116182390-116182412 CTGAAATGGGGAAGAGGTGTGGG + Intronic
996152865 5:120061455-120061477 CTTAAATTGGAGAGCAGTGTTGG + Intergenic
997274864 5:132576741-132576763 CTGCAATTGGAGTGAAGAGGAGG - Intronic
999617171 5:153436811-153436833 ATCTAATTGGAAAGAACTGTGGG - Intergenic
1001764685 5:174236232-174236254 CTGCAATGACAAAGAAGTGGAGG + Intronic
1003054712 6:2807722-2807744 CTGCAATGACAAATAAGTGTAGG + Intergenic
1003314692 6:5001886-5001908 TTGCAATTGGCCACAAGTGTTGG - Intronic
1005027897 6:21481484-21481506 AAGCATTTGGAAAGAAGTGTCGG - Intergenic
1005307818 6:24530734-24530756 CAGCCATGGGAAACAAGTGTAGG - Intronic
1005405968 6:25488385-25488407 CTGCAATTTGATGGAAGTGTTGG + Intronic
1006573076 6:35021370-35021392 CTGCTCCTGGAAAGAAGTGCAGG + Intronic
1008286042 6:49651968-49651990 ATGCAAATGAAATGAAGTGTAGG + Intergenic
1011668935 6:89663511-89663533 CTCCAATTGGACAGAAATTTGGG + Intronic
1012107360 6:95180096-95180118 CTGAAGTTGGAATGAAGTGTTGG - Intergenic
1013473519 6:110486977-110486999 CTGGAATTGGAGAGAAGTGTGGG - Intergenic
1014739799 6:125135777-125135799 GTGAAAATGGAAAGAAGTGGAGG - Intronic
1015265186 6:131284487-131284509 CTGCATTTTGGAAAAAGTGTTGG - Intergenic
1017593866 6:156007577-156007599 CTGCAATGGGTAAGGAGTCTAGG + Intergenic
1018092705 6:160358816-160358838 CTGCAATTGGAAAGAAGTGTGGG - Intronic
1024115558 7:46189695-46189717 CTTCAATTGGGGAGTAGTGTTGG - Intergenic
1024131238 7:46354800-46354822 CTGCAATTGGAAGCCAGTGCCGG - Intergenic
1024619669 7:51146791-51146813 CTTGAGTTGGAAAGAAGTGAGGG - Intronic
1030289473 7:107858140-107858162 CTGCAAATGGTGAGAAGTGTTGG - Intergenic
1031134251 7:117868866-117868888 CTGCAATTTCACAGAAATGTGGG - Intronic
1031563179 7:123262845-123262867 GTGGAATTGGAAAGAAGGGGAGG - Intergenic
1037111180 8:15165769-15165791 CTGAAGTTGCAAAGAAGTGGTGG + Intronic
1037235307 8:16713175-16713197 GTGCAATTGGCCAGAAATGTTGG + Intergenic
1038336897 8:26652894-26652916 ATGCAATTGGAAAGAAAGTTTGG + Intronic
1038408131 8:27337438-27337460 CTGCAATTAGATAGCAGTGATGG - Intronic
1038409448 8:27346784-27346806 CAACAATTGGAATGAGGTGTTGG - Intronic
1038848207 8:31249403-31249425 CTGAGATGGGAAAGAGGTGTAGG + Intergenic
1039650265 8:39333911-39333933 CTTCACTTGGACAGCAGTGTGGG - Intergenic
1039951973 8:42179905-42179927 CTGTAAGTGGAAGGAAGTCTCGG - Exonic
1041411327 8:57559735-57559757 CTGCACATTGCAAGAAGTGTTGG + Intergenic
1041926694 8:63244157-63244179 GTGAAATTGGAAAGAAGTGAGGG - Intergenic
1042402095 8:68361266-68361288 CTGCAACTGGAAAGCACTGAAGG + Intronic
1043835798 8:85044265-85044287 ATGCAATTGCAAAGAAGCCTAGG - Intergenic
1045260734 8:100571260-100571282 CTAGAAGTGGAAAGAAGTGATGG + Intergenic
1046912431 8:119643858-119643880 CTGCGATTGGAAGGGTGTGTGGG + Intronic
1047791807 8:128210972-128210994 CTGCTATTTGAAAGGAGTGAGGG - Intergenic
1049167229 8:141133901-141133923 CTGGGACTGGAAAGAGGTGTGGG + Intronic
1050641881 9:7677121-7677143 CTGCAATGGGAAAGAAGCTGGGG + Intergenic
1052170857 9:25394826-25394848 TTGCAAGTGCAAAGAAGGGTAGG - Intergenic
1056017901 9:82410536-82410558 TTGCATTTAGAAAGAAGAGTAGG - Intergenic
1056153128 9:83807578-83807600 ATGCAATTGGAGAGAAGCATAGG - Intronic
1185527959 X:794189-794211 CTGCAGTTGGAATTAAGTGGGGG + Intergenic
1185761676 X:2693388-2693410 CTGCAATTGGAAGGATAGGTTGG - Intronic
1186639708 X:11442509-11442531 GTGAAATTGTAAAGAAGTGCTGG - Intronic
1190475627 X:50824492-50824514 CTGAAATTCCAAGGAAGTGTAGG - Intergenic
1191746527 X:64495343-64495365 CTGAAATTAGAAAGTAGTGATGG + Intergenic
1192281493 X:69691817-69691839 CCACAATTTGAAAGAAGTTTTGG - Intronic
1192491457 X:71579689-71579711 CAGAAGTTGGATAGAAGTGTGGG + Intronic
1197027314 X:121769256-121769278 CTGGAATTGGAAGGTAGTGATGG - Intergenic
1197435601 X:126424887-126424909 CTGCCTTAGGAAAGAAGAGTGGG - Intergenic