ID: 1018092706

View in Genome Browser
Species Human (GRCh38)
Location 6:160358817-160358839
Sequence ACTGCAATTGGAAAGAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018092706_1018092710 -4 Left 1018092706 6:160358817-160358839 CCACACTTCTTTCCAATTGCAGT 0: 1
1: 0
2: 1
3: 16
4: 247
Right 1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG 0: 1
1: 0
2: 1
3: 12
4: 173
1018092706_1018092715 26 Left 1018092706 6:160358817-160358839 CCACACTTCTTTCCAATTGCAGT 0: 1
1: 0
2: 1
3: 16
4: 247
Right 1018092715 6:160358866-160358888 CCCTGGACTTTCCTAAAACCGGG 0: 1
1: 0
2: 0
3: 14
4: 107
1018092706_1018092712 9 Left 1018092706 6:160358817-160358839 CCACACTTCTTTCCAATTGCAGT 0: 1
1: 0
2: 1
3: 16
4: 247
Right 1018092712 6:160358849-160358871 GGGACGCTGGGACAGAGCCCTGG No data
1018092706_1018092711 -3 Left 1018092706 6:160358817-160358839 CCACACTTCTTTCCAATTGCAGT 0: 1
1: 0
2: 1
3: 16
4: 247
Right 1018092711 6:160358837-160358859 AGTCTGAGCAGAGGGACGCTGGG No data
1018092706_1018092713 25 Left 1018092706 6:160358817-160358839 CCACACTTCTTTCCAATTGCAGT 0: 1
1: 0
2: 1
3: 16
4: 247
Right 1018092713 6:160358865-160358887 GCCCTGGACTTTCCTAAAACCGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018092706 Original CRISPR ACTGCAATTGGAAAGAAGTG TGG (reversed) Intronic
901029328 1:6297790-6297812 ACCGCAGTGGGAAAGAGGTGAGG + Intronic
905512425 1:38532540-38532562 CCTGCAATTGATAAAAAGTGTGG - Intergenic
905964682 1:42081822-42081844 ACTGCCACTGGGACGAAGTGTGG - Intergenic
906314081 1:44775239-44775261 AATGGAATTGGAAACGAGTGTGG - Intronic
909394047 1:75149917-75149939 ACTGCAATGGGGAAGCAGAGAGG + Intronic
909884450 1:80923418-80923440 ACTGCAAGTGGAATGATTTGTGG - Intergenic
915674219 1:157515650-157515672 ACAGCAGTTGGAGAGACGTGTGG + Exonic
916685120 1:167137271-167137293 ACTGCAATTGCAGAGAAATCTGG + Intergenic
916943605 1:169701622-169701644 ACTGCCACTGGAATGAAGAGGGG + Exonic
917634365 1:176920486-176920508 ACTGTAAGGGGAAACAAGTGGGG - Intronic
918324409 1:183395806-183395828 ACTGCAATGTAAAAGAAGGGGGG + Intronic
918433665 1:184488282-184488304 ACTACACTTTGAAAGAAATGAGG - Intronic
918942317 1:191016582-191016604 ACTCTAATTGGAAAGAAATTTGG - Intergenic
919396663 1:197058322-197058344 GCAGCAATAGGAAAGTAGTGTGG - Intronic
921141232 1:212308826-212308848 ACTGGCATTAGAAAGAATTGGGG - Intronic
921224606 1:213005793-213005815 AGTGAGATTGGAATGAAGTGAGG - Intronic
921672785 1:217945030-217945052 AGTCAGATTGGAAAGAAGTGAGG - Intergenic
1064589144 10:16870605-16870627 ACTGCAGTGGGAAGGCAGTGTGG - Intronic
1069154893 10:65016269-65016291 CTTGCATTTGGAAAGAAGTATGG + Intergenic
1069215642 10:65815632-65815654 ACTGCAAGGCGAAAGGAGTGAGG + Intergenic
1069627446 10:69876990-69877012 ACTGCTATGGGAGGGAAGTGTGG - Intronic
1069995143 10:72337243-72337265 CCTGCAACTGGAGAGATGTGAGG - Intronic
1071198310 10:83187522-83187544 CCTGACCTTGGAAAGAAGTGTGG + Intergenic
1074469130 10:113711231-113711253 ACTGCTATTGGACAGAAGAAAGG - Intronic
1074654715 10:115572062-115572084 ATTGCAAATGGACAGAAGTTTGG + Intronic
1077768485 11:5188821-5188843 ACTCCACCTGGAAAGAAGAGTGG - Intergenic
1078741450 11:14070296-14070318 ACTGGAATTGGGAAGAAGGCTGG + Intronic
1079170393 11:18088617-18088639 ACTGCAATGGGAAAATACTGGGG + Intronic
1079623304 11:22582400-22582422 ACTGAAATTGGAAGAAAGGGGGG + Intergenic
1080936610 11:36870331-36870353 GATGCAATTGGAAAGTTGTGTGG + Intergenic
1082943366 11:58732245-58732267 ACTTGAATGGGAAAGAGGTGAGG - Intergenic
1088130527 11:106483659-106483681 ACAGCAATGGGAATTAAGTGAGG + Intergenic
1088627750 11:111743882-111743904 AGAGCAATTAGAATGAAGTGTGG + Intronic
1090921234 11:131207569-131207591 ACTGAAGTTGGAAAGCAGAGTGG + Intergenic
1091974971 12:4817115-4817137 ATTGCCATGGGAAGGAAGTGGGG + Intronic
1093172949 12:15879437-15879459 ACAGCCATGGGGAAGAAGTGGGG - Intronic
1093652759 12:21662940-21662962 ACACCATGTGGAAAGAAGTGGGG - Intronic
1098116912 12:67188680-67188702 AGTGCAATTATAAAGAAGAGAGG + Intergenic
1098694378 12:73534144-73534166 AGTGCAACTGTAAAGGAGTGAGG - Intergenic
1100092753 12:90991729-90991751 ACTGAAATTGGAATGATTTGTGG - Intronic
1100617582 12:96242880-96242902 ACAGCCATTGGAAAGAACCGAGG - Intronic
1101097540 12:101358487-101358509 AATGATATTAGAAAGAAGTGTGG - Intronic
1102407856 12:112689623-112689645 TCTGCAATTTGAAATAAGTCAGG + Intronic
1102856289 12:116297174-116297196 ACTGAAATTGGGAGGAAATGAGG + Intergenic
1102865861 12:116373542-116373564 ACTGCAATTTTAAACAACTGTGG + Intergenic
1104444396 12:128822223-128822245 ACTGTAACTGCCAAGAAGTGAGG - Intronic
1105328924 13:19396272-19396294 ACTGCAAATGGTCAGGAGTGTGG + Intergenic
1105493407 13:20909100-20909122 AGTACAGTTGGAAAAAAGTGAGG - Intergenic
1106014935 13:25859715-25859737 ACTGAACTTGGAAAGAATTTTGG - Intronic
1106103371 13:26713436-26713458 ATTTCAACTGGACAGAAGTGTGG - Intergenic
1108461207 13:50669256-50669278 ACTGCAATTGGCAAGAACACTGG - Intronic
1108511414 13:51159301-51159323 ACTGTCATTGAAAACAAGTGTGG - Intergenic
1109010832 13:56941668-56941690 ATTGAAATTGTAAAGAAGTAAGG - Intergenic
1109186928 13:59280842-59280864 ACTGCAATTTGTAAGATGTTGGG + Intergenic
1110155211 13:72308808-72308830 AATGCAACTAGAAAGAAGTCTGG - Intergenic
1111822489 13:93229654-93229676 ACTGTAATTGTAAAAAGGTGGGG - Intronic
1112786386 13:102956218-102956240 AATGAAAATGGAAAGAAGTTTGG - Intergenic
1113559139 13:111264012-111264034 CCTGCAAATGGACAGAACTGTGG + Intronic
1114382919 14:22227131-22227153 AGTGGAATTGAAAAGAAGTCAGG + Intergenic
1114701174 14:24680033-24680055 CCTGCAGGTGGAAAGGAGTGAGG - Intergenic
1114729991 14:24982375-24982397 GCTGCAATTGGACAGAAGAAGGG - Intronic
1115183751 14:30660181-30660203 ATGGCAATTAAAAAGAAGTGAGG - Intronic
1116656151 14:47656274-47656296 AGTGCAATAGGAAAGATGTAGGG - Intronic
1120302986 14:82731937-82731959 ACAGCAGATGGAAAGCAGTGAGG - Intergenic
1121019952 14:90573705-90573727 ACAGCAAGTGGAGTGAAGTGGGG - Intronic
1121123474 14:91391014-91391036 ACTGAAATGGGAAGGAAGTAAGG + Intronic
1121331979 14:93055463-93055485 ACTGAAAACAGAAAGAAGTGTGG - Intronic
1124560786 15:30771471-30771493 TCTGAATTTGGAAAGAAGTTAGG + Intronic
1124670423 15:31633982-31634004 TCTGAATTTGGAAAGAAGTTAGG - Intronic
1125633278 15:41166122-41166144 CCTGAAATTGCAAAGAGGTGGGG + Intergenic
1126694000 15:51310656-51310678 AGTGCAAGGGGAAAAAAGTGAGG - Intronic
1128444708 15:67748547-67748569 GCTGCAATGGAAAAGAAGAGAGG - Exonic
1128870300 15:71150078-71150100 ACGCCACTTGGAAAGGAGTGTGG + Intronic
1129190327 15:73933776-73933798 ACAGCAATTGGAAGGAGGTGTGG - Intronic
1129221879 15:74135917-74135939 ACTCCAACTGGCCAGAAGTGGGG - Exonic
1130357901 15:83151759-83151781 AGTGGAAATTGAAAGAAGTGAGG + Intronic
1130719250 15:86370767-86370789 ACTGCTAGTGGAAAGAGGAGTGG - Intronic
1131745453 15:95442568-95442590 ACTGCAACTGGAAAGAACTCAGG + Intergenic
1134335278 16:13293647-13293669 ACTGTAAAAGGAAATAAGTGAGG - Intergenic
1135146819 16:19969802-19969824 ACTTGACTTGGAAAGATGTGTGG - Intergenic
1135500842 16:22994579-22994601 ACTGCAAATGGAAGAAAGAGTGG - Intergenic
1141978306 16:87533104-87533126 ACTGCAATTGGTAGGAGGTGAGG + Intergenic
1143629171 17:8127512-8127534 ACGGCAATTGGAAGCCAGTGGGG + Intergenic
1144524955 17:15981450-15981472 ACTGTAATAAGAAGGAAGTGGGG + Intronic
1144993357 17:19249349-19249371 ACTGCAAACAGAAAAAAGTGAGG - Intronic
1146202141 17:30867910-30867932 ACAGCAATTAAAAAGAACTGAGG - Intronic
1146323489 17:31865664-31865686 AGTGCTATTAGAAAAAAGTGGGG + Intronic
1147610770 17:41800836-41800858 ACTGCAGCTTGAAAGAGGTGGGG + Intergenic
1147984808 17:44299634-44299656 ACTGACATTGGAAAGAAAGGAGG + Intergenic
1151084340 17:71363691-71363713 AATGCAAATGGGAACAAGTGAGG - Intergenic
1151165369 17:72198696-72198718 ACTCCAATTAGAGAGAAGGGAGG - Intergenic
1153547641 18:6225041-6225063 AGTGCTATTGGAAAGTAGGGGGG + Intronic
1157745901 18:50135223-50135245 AGTGAAATTGGAAGGAAATGTGG - Intronic
1158119278 18:54030468-54030490 GCTGCAAATGGAAAGCAGAGTGG + Intergenic
1158450688 18:57561773-57561795 CCTGCGATTGGAAAGGAGGGGGG - Intronic
1159672212 18:71235729-71235751 ATGGAAAATGGAAAGAAGTGAGG + Intergenic
1160984308 19:1830974-1830996 ACTGCTATGGGGAAGAAGAGGGG + Intronic
1162000948 19:7744822-7744844 GCTCCACTTGGAAAGAAGGGAGG - Intronic
1164011430 19:21206279-21206301 ACTGGAACTGGAAAAAAATGAGG - Intergenic
1165156019 19:33788503-33788525 ACTGGAATTGGGGAGAATTGAGG - Intergenic
1165700914 19:37936936-37936958 AATGCATTTAGAAAGAGGTGAGG - Intronic
1166978426 19:46618723-46618745 TCTGGAATTGGATAGTAGTGAGG - Intergenic
1168348654 19:55663211-55663233 ACTGCAAGTGGACTGCAGTGAGG - Intronic
925383392 2:3444446-3444468 ACTGACATTGGGAAGAAATGTGG + Intronic
925694642 2:6563144-6563166 CCTGCAGTTGGAAAGATTTGAGG - Intergenic
926107785 2:10163196-10163218 ACTGCTCTTGGAAAGAAATCAGG + Intronic
926234508 2:11029019-11029041 ACTGCAATTAGCAGGAAGTAGGG + Intergenic
926712714 2:15895003-15895025 ACTGCACTTGAATAAAAGTGTGG - Intergenic
926930079 2:18028757-18028779 ACTTCAAATGGCAAGAAGAGAGG - Intronic
927270674 2:21206734-21206756 ACAGCAGATGGGAAGAAGTGGGG + Intergenic
927457273 2:23264663-23264685 ACTGCATTTTGAAAGCTGTGTGG - Intergenic
929474005 2:42227056-42227078 ACTGAAAGTGGAAAAAAGTCTGG - Intronic
933100238 2:78246539-78246561 ACTGCAAAAGGAAATAAGAGAGG + Intergenic
933588515 2:84206173-84206195 TCTGCAAGTGGAAAGAAGGGTGG - Intergenic
935346873 2:102116302-102116324 CCTGGAGATGGAAAGAAGTGTGG + Intronic
936321037 2:111467091-111467113 ACTGCAATTAGAATGTACTGTGG - Intergenic
937141088 2:119601164-119601186 ACTGGACTTGGCAAGAAGAGAGG + Intronic
937669355 2:124521926-124521948 ACTGCCTTTGGGAGGAAGTGGGG + Intronic
938128230 2:128689969-128689991 ACTTCACTGGGAGAGAAGTGAGG + Intergenic
939176021 2:138747850-138747872 ACTGAAACTGGAGAGAAGGGAGG - Intronic
941223641 2:162816643-162816665 ACTGCTATAAGAAATAAGTGTGG + Intronic
941267990 2:163387518-163387540 ACTGCTAATGACAAGAAGTGAGG - Intergenic
942021690 2:171872493-171872515 GCTGCAACTGGAAAGAAGGATGG + Intronic
942735330 2:179104446-179104468 ACTGTAATAGAAAAGAAGTGAGG + Exonic
944424971 2:199571428-199571450 ACTGCACTGTGAAAGAAGTCGGG + Intergenic
944678573 2:202055125-202055147 ACTGGAATTGAAAAGAAGTCAGG + Intergenic
945395928 2:209317555-209317577 ACTGCAATTTGAACCTAGTGAGG - Intergenic
947257417 2:228181417-228181439 ACTGCACTTGTAAATAAGTCCGG - Intronic
947572200 2:231244973-231244995 ACCACAAGAGGAAAGAAGTGAGG + Intronic
1169265828 20:4166935-4166957 AATGTAATTGGAAAGAAGTCTGG + Intronic
1169318535 20:4612337-4612359 ACTGCAAGTGGAGAGAAGAGGGG + Intergenic
1169953200 20:11071250-11071272 ATTAAAATTGGGAAGAAGTGGGG - Intergenic
1170005586 20:11665390-11665412 ACTGATAGTGGAAACAAGTGAGG - Intergenic
1170098819 20:12676021-12676043 AATGCAATTAAGAAGAAGTGTGG - Intergenic
1170122410 20:12925551-12925573 ACTGCAATGGGAAGGAAAGGGGG - Intergenic
1170658034 20:18308846-18308868 ACAGCAATAGGAAAGAAGGAAGG + Intronic
1172351253 20:34243544-34243566 ACTGCATTTGCTAAGAACTGTGG + Intronic
1173783925 20:45778584-45778606 ACTGGAAGAAGAAAGAAGTGAGG - Intronic
1173984205 20:47248517-47248539 AGGGCATTTGTAAAGAAGTGGGG - Intronic
1174593007 20:51661271-51661293 ACTGCATTTGGAAAGAAAACTGG - Intronic
1174977951 20:55355799-55355821 TCTGCATTTGGAGAGAAGTGGGG - Intergenic
1177530880 21:22356182-22356204 TCTCCAATAGGAAAGAAGGGTGG - Intergenic
1177548864 21:22595349-22595371 ACTGCAATTGCAAAGGCTTGTGG - Intergenic
1177668074 21:24187775-24187797 ATTGCAATGAGAAAGAGGTGTGG - Intergenic
1178009756 21:28270741-28270763 ACTGTAACTGGAGAGAAATGAGG - Intergenic
1180612514 22:17107193-17107215 GCTGCTTCTGGAAAGAAGTGTGG + Intronic
1181874955 22:25933170-25933192 TCTGAAATTGGAAAGAAATAGGG - Intronic
1182339315 22:29606537-29606559 ACTGCCATTGGAAAGAGATTAGG - Intronic
1183011788 22:34952690-34952712 AGTGCGATTGGAGAGCAGTGAGG - Intergenic
1183575739 22:38687751-38687773 AGTGCAATAGGACAGACGTGTGG - Exonic
1184203488 22:42985471-42985493 CCTGCATGTGGAGAGAAGTGAGG - Intronic
950235716 3:11318556-11318578 AATGCACTTGGACAGCAGTGTGG - Intronic
950801335 3:15554091-15554113 ACTGCAGGAAGAAAGAAGTGAGG - Intergenic
951245587 3:20337775-20337797 AGTGGACTTGGAAAGAAATGGGG + Intergenic
951342986 3:21511609-21511631 ACTACCCTTGGTAAGAAGTGAGG - Intronic
951641777 3:24844509-24844531 ACTGCAGTGGGAAAAAACTGGGG + Intergenic
952504303 3:33994145-33994167 AAGGCAATAGGAAGGAAGTGTGG + Intergenic
952536152 3:34311099-34311121 ACTGCATTTGCAAAGAGGTTAGG - Intergenic
953387808 3:42516523-42516545 ACTGCAGTGGGACAGAAGAGAGG - Intronic
955533263 3:59897043-59897065 ACTGCAGTTGGAAAGGTGGGTGG - Intronic
956846242 3:73185711-73185733 AATGCAATTGCAAAGGAGGGAGG + Intergenic
957937396 3:86962456-86962478 ACTGCCATAGGAATGAAGTAAGG - Intronic
958119571 3:89267321-89267343 ACTTCAATTGGAAGGGAATGAGG + Intronic
958122099 3:89304217-89304239 ACTGGACTAGAAAAGAAGTGGGG - Intronic
961528420 3:127524175-127524197 AGTGCAATTGGCAAGAGATGAGG - Intergenic
965692419 3:171371748-171371770 AATGGAATTAGAAAGAAATGAGG + Intronic
965920192 3:173904268-173904290 ACTGAAATTGGAAAGGAGAAAGG - Intronic
967763398 3:193250847-193250869 TCTCCAATTGGAAAAAGGTGCGG - Intronic
969412420 4:7037835-7037857 CCTAGAATTGGAAAGAACTGTGG + Intergenic
969932006 4:10639988-10640010 ACTGAAAATAGAAAGTAGTGTGG - Intronic
969951732 4:10843867-10843889 TCTGCATGTGGAAAGAAATGAGG - Intergenic
970043624 4:11824582-11824604 ATTGCAATGGGAAAGGAGTTAGG - Intergenic
970836336 4:20411944-20411966 ACTGCAAATGGAGAGTTGTGAGG + Intronic
971722098 4:30257754-30257776 ACTGCAATTGAATAAAAGTATGG - Intergenic
971766488 4:30838713-30838735 CCTGGAAGTGGAAAGAACTGTGG + Intronic
972109136 4:35533401-35533423 AGTGCAATTGGAAATTAATGAGG - Intergenic
972457112 4:39265320-39265342 ATTGAAAGTGTAAAGAAGTGAGG - Intronic
972649505 4:41003148-41003170 ACTGAGATTGGGAATAAGTGTGG - Intronic
976466305 4:85372844-85372866 ACTGCAGTTTGAATGGAGTGGGG + Intergenic
976727578 4:88229672-88229694 AAAGCAATGGGAAAAAAGTGGGG - Intronic
978006284 4:103621187-103621209 AGAGCAATTGAAAAGCAGTGGGG + Intronic
978104332 4:104883315-104883337 ACTGTTCTTGGAAAGAAGTGAGG + Intergenic
981186184 4:141806696-141806718 AGTGCAATTGGAAGCAAGTCCGG + Intergenic
982714714 4:158794696-158794718 ACTGCAATAAGAAACATGTGAGG - Intronic
983405628 4:167325878-167325900 AATGCAATAGGAAATAAATGTGG - Intergenic
984799651 4:183702376-183702398 ATTGCAATAGGAAAAAAATGGGG + Intronic
986933194 5:12852974-12852996 ACAGGAATTAGAAAGAGGTGAGG + Intergenic
987240650 5:15995215-15995237 GCTGCAAATGGAAAGAAATGAGG + Intergenic
989620900 5:43383429-43383451 ACTGAAATGGGAGAAAAGTGGGG + Intronic
989810722 5:45669956-45669978 TCTGTAATTGGAATGAAGGGAGG + Intronic
990868611 5:60406997-60407019 ACTGAAATTGGAAATAAGGTAGG + Intronic
991319275 5:65351132-65351154 ACTGGAATTGGAAAGAAATATGG - Intronic
992170161 5:74093434-74093456 AATGAATTTGGAAAGTAGTGGGG - Intergenic
995230618 5:109757427-109757449 GCTGCAAGTGGAAAGATGAGGGG - Intronic
995817048 5:116182389-116182411 ACTGAAATGGGGAAGAGGTGTGG + Intronic
997902427 5:137779125-137779147 ACTGCATTTGGAAGGAAAAGAGG - Intergenic
998772371 5:145560802-145560824 ACTGCACTGGGAAAGAAGAGAGG - Intronic
998815315 5:146007963-146007985 AAAGCAATTGGAAGGAAGGGAGG + Intronic
999472794 5:151870806-151870828 ACTGGAATTGGAGAAAAGAGAGG - Intronic
1003441877 6:6150510-6150532 ATTGTAATTTGAAAGAAATGCGG + Intronic
1005115241 6:22328866-22328888 AATGCAAATGGGAATAAGTGTGG - Intergenic
1008184771 6:48375347-48375369 ACTGGCATTGCAAAGCAGTGGGG + Intergenic
1008430506 6:51411071-51411093 ACTGCAAGAAGAAAGAGGTGGGG - Intergenic
1008527814 6:52424391-52424413 ACTGCATTTGGAAAATAGTCTGG - Intronic
1009301354 6:62027147-62027169 ACTGTAGTTTGAAGGAAGTGAGG + Intronic
1013473520 6:110486978-110487000 TCTGGAATTGGAGAGAAGTGTGG - Intergenic
1014122672 6:117743770-117743792 AATGCAATTAGAAAGAAAAGAGG + Intergenic
1014930081 6:127325390-127325412 ACTGAAATATGAATGAAGTGTGG + Intronic
1017172399 6:151470034-151470056 ACTGAAATTGGAAATAAATCTGG + Exonic
1018092706 6:160358817-160358839 ACTGCAATTGGAAAGAAGTGTGG - Intronic
1019676738 7:2317958-2317980 ACAGCAGCTGGAAGGAAGTGAGG - Intronic
1020529356 7:9311520-9311542 TCAGCAATTTGACAGAAGTGAGG - Intergenic
1021623274 7:22568618-22568640 AGTGAAATTGGAGAGAATTGAGG - Intronic
1021781269 7:24109093-24109115 ACTGAAACAGGAAAGAGGTGGGG - Intergenic
1022701694 7:32767165-32767187 AATGCAATTGCAGAGAAATGAGG - Intergenic
1022822978 7:33979512-33979534 ACAGCAATAGGAAAGAAGAAGGG - Intronic
1022905699 7:34853480-34853502 AATGCAATTGCAGAGAAATGAGG - Intronic
1024619670 7:51146792-51146814 TCTTGAGTTGGAAAGAAGTGAGG - Intronic
1024831548 7:53465182-53465204 ATTACAAGTGGGAAGAAGTGAGG - Intergenic
1026256692 7:68718385-68718407 ACTGCAAGTGGAGAAAAGTTAGG - Intergenic
1026930293 7:74219938-74219960 ACTACAAAGGGCAAGAAGTGGGG - Exonic
1028971618 7:96865242-96865264 ACAGTATTTGGAAAGAAGTTGGG - Intergenic
1035455067 7:159002857-159002879 ACTGCTATAGGAAAGAGGTGAGG + Intergenic
1035612103 8:973536-973558 ACCCCATCTGGAAAGAAGTGAGG - Intergenic
1037047061 8:14319765-14319787 ACTGGAAATGAAGAGAAGTGAGG + Intronic
1037275213 8:17171126-17171148 TCTGGAATTGGAAAGGAGGGGGG + Intronic
1041926695 8:63244158-63244180 AGTGAAATTGGAAAGAAGTGAGG - Intergenic
1043254090 8:78110962-78110984 ACTACAATTTCAAAAAAGTGTGG + Intergenic
1043335896 8:79176632-79176654 ACTGCTATTGGATAGAACTTTGG + Intergenic
1043822003 8:84878152-84878174 ACTGCACTTTGAAAGAAGGCTGG + Intronic
1045262401 8:100588255-100588277 TCTGCAATTGGAAACAATTCTGG + Intronic
1046004893 8:108467088-108467110 TTTACAATTGGAAAGAACTGAGG - Intronic
1046943380 8:119952772-119952794 AGTGAAAATGGGAAGAAGTGAGG + Intronic
1047040078 8:120983620-120983642 ACTGGAATTGGTAATAGGTGTGG + Intergenic
1047466604 8:125121970-125121992 ACTGCAATTGGGAAGGGGTTAGG - Intronic
1047512438 8:125525947-125525969 GCTTCGATTAGAAAGAAGTGGGG - Intergenic
1047791808 8:128210973-128210995 TCTGCTATTTGAAAGGAGTGAGG - Intergenic
1048715369 8:137262975-137262997 AGTGCATTTAGAAAGAAGAGGGG - Intergenic
1048807720 8:138255904-138255926 ACTGCAGTGGGAAAGAAAGGGGG + Intronic
1050529029 9:6571784-6571806 ACTGAAACTGCAAATAAGTGGGG + Intronic
1050641880 9:7677120-7677142 GCTGCAATGGGAAAGAAGCTGGG + Intergenic
1050769501 9:9179344-9179366 TCTGCATTTGGAAATATGTGGGG - Intronic
1052187599 9:25618590-25618612 ACTGAAATTGGAAAGAACTAGGG + Intergenic
1053299725 9:36940464-36940486 ACTGTAATTTTAAAGACGTGTGG + Intronic
1055100354 9:72457894-72457916 ACTGCACTTGAAAACAGGTGAGG + Intergenic
1055449749 9:76420150-76420172 ACAGCTATTGGAAGCAAGTGAGG + Intronic
1058730837 9:107848397-107848419 ACTGAAATGTCAAAGAAGTGAGG + Intergenic
1059786915 9:117596419-117596441 ACTGAAAGAGGAAAGAAGAGAGG + Intergenic
1185527958 X:794188-794210 TCTGCAGTTGGAATTAAGTGGGG + Intergenic
1187630210 X:21161025-21161047 AATGCACTTGGAATGAAGTCTGG - Intergenic
1188314555 X:28657336-28657358 ACTGGAACTGGAAAAAAATGTGG - Intronic
1188468296 X:30507955-30507977 ACTGTGACTGGAAAGAAGAGAGG - Intergenic
1188926726 X:36052772-36052794 AATACAATTAGAAAGAATTGAGG + Intronic
1189977307 X:46475020-46475042 AATGCCTTCGGAAAGAAGTGAGG + Intronic
1192800839 X:74463251-74463273 ATTGCAATTGGAAAGGAAAGGGG + Intronic
1196710234 X:118754678-118754700 ACTGCATCTGCAAAGGAGTGGGG - Intronic
1197721230 X:129746090-129746112 TCCTCCATTGGAAAGAAGTGAGG - Intronic
1199611368 X:149618295-149618317 ACTTCGATTGGAAAAAAGGGAGG + Intronic
1199890342 X:152072713-152072735 AGTGGAATTGGAAAGAAGCTGGG + Intergenic
1200172701 X:154089608-154089630 ACTGCTATTTAAAAGAAATGAGG + Intronic
1201673910 Y:16557997-16558019 GCTGCAATTGGAAACAAATACGG - Intergenic
1202170686 Y:22040628-22040650 ACTGAAATTGGAATGGAGTATGG - Intergenic
1202220677 Y:22545745-22545767 ACTGAAATTGGAATGGAGTATGG + Intergenic
1202322436 Y:23649918-23649940 ACTGAAATTGGAATGGAGTATGG - Intergenic
1202548335 Y:26020138-26020160 ACTGAAATTGGAATGGAGTATGG + Intergenic