ID: 1018092710

View in Genome Browser
Species Human (GRCh38)
Location 6:160358836-160358858
Sequence CAGTCTGAGCAGAGGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018092706_1018092710 -4 Left 1018092706 6:160358817-160358839 CCACACTTCTTTCCAATTGCAGT 0: 1
1: 0
2: 1
3: 16
4: 247
Right 1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG 0: 1
1: 0
2: 1
3: 12
4: 173
1018092704_1018092710 -2 Left 1018092704 6:160358815-160358837 CCCCACACTTCTTTCCAATTGCA 0: 1
1: 0
2: 0
3: 14
4: 274
Right 1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG 0: 1
1: 0
2: 1
3: 12
4: 173
1018092705_1018092710 -3 Left 1018092705 6:160358816-160358838 CCCACACTTCTTTCCAATTGCAG 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG 0: 1
1: 0
2: 1
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018092710 Original CRISPR CAGTCTGAGCAGAGGGACGC TGG Intronic
901680715 1:10911233-10911255 CACTCAGAGCAGAGGAACACAGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
903474111 1:23607599-23607621 CAGTCTGAGCTGGGTGACTCTGG + Intronic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG + Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912598627 1:110904206-110904228 CACTCTGAAGAGAAGGACGCAGG + Intergenic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1067561887 10:47310152-47310174 GATTCTGAGGAGAGGGACCCGGG + Exonic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1075031699 10:119028929-119028951 CGGTAAGAGCGGAGGGACGCAGG - Intergenic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1076671002 10:132121097-132121119 CAGTCAGAGAAGAGGCAGGCTGG + Intronic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1079062112 11:17258172-17258194 CAGTTTGAGCTGAGGTATGCAGG + Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1083888852 11:65585746-65585768 CTATCTGATCAGAGGGACCCTGG + Intronic
1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG + Exonic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG + Intronic
1091306187 11:134537555-134537577 AAGAATGAGCAAAGGGACGCTGG - Intergenic
1092105216 12:5916984-5917006 AAGTCTGATGACAGGGACGCTGG + Intronic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1101559739 12:105845132-105845154 GATTCTGATCAGAGGGACGTGGG - Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105708106 13:22981365-22981387 AGGTCTGAGCAGAGGGTCCCTGG + Intergenic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1121223931 14:92307654-92307676 CAGTCTAAGAAGAGAGACTCTGG - Intergenic
1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG + Intergenic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG + Intronic
1131277473 15:90994270-90994292 CAGTCGGCGCCGAGGGAGGCCGG - Intronic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG + Intergenic
1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG + Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134289829 16:12895136-12895158 GAGTCTGAGCAGAGAGACAGGGG + Intergenic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1141146331 16:81532841-81532863 CTGTCTGGGCAGAGAGGCGCAGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1143653123 17:8276636-8276658 CACTCTGAGAGGAGGGAGGCAGG + Intergenic
1147876931 17:43628414-43628436 AAGTCTGAGCAGAGAGTCTCTGG - Intergenic
1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG + Exonic
1149493535 17:57102069-57102091 CAGCCTGTGCAGAGGTACGTGGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151846503 17:76659617-76659639 CTGTCTGAGAAGAGGGCCTCAGG - Intergenic
1152465784 17:80465439-80465461 GAGTCTGGGCAGCGGGACACGGG - Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1159479782 18:68974283-68974305 AACACTGAGCAGAGGAACGCTGG - Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1162484776 19:10952886-10952908 CAGTCTGAGAAGAGTGAGTCTGG - Intergenic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1164078694 19:21844114-21844136 CAGTCTGGGCCTAGGGCCGCAGG - Intronic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1167208099 19:48116002-48116024 GAGACTGAGCAGGGGGTCGCTGG - Intronic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG + Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
932421205 2:71602528-71602550 ATGTCAGTGCAGAGGGACGCTGG - Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
935970566 2:108527279-108527301 CAGTCTGAGGAGAGTCAGGCGGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG + Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG + Intergenic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947971947 2:234332125-234332147 CAGTCCGAACAGAGAGACGCAGG - Intergenic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183180048 22:36253819-36253841 AAGTCTGAACAGAGGGACAGAGG - Exonic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
952519786 3:34145207-34145229 CACTCTGAGAAGAGGGACTTGGG + Intergenic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954898378 3:53996860-53996882 CAGTCACTGCTGAGGGACGCTGG - Intergenic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
962665367 3:137648927-137648949 CAGTTTGAGCAAAGGTACACAGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
978279029 4:106987542-106987564 CTGCCTGAGGAAAGGGACGCAGG + Intronic
980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG + Intergenic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1003985178 6:11428048-11428070 CGGACTGAGCACAGGGACCCGGG - Intergenic
1004352389 6:14901760-14901782 CAATCAGAGCACAGGGACACAGG + Intergenic
1005349914 6:24924061-24924083 CAGGCTGAGCAGACCCACGCTGG + Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG + Intergenic
1007513336 6:42391527-42391549 CAGTCTCAGCAGATGGCCTCAGG + Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1010579085 6:77572001-77572023 GAGTCAGAGCAGAAGGACGTAGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1034983619 7:155494264-155494286 CCGTCAGAGCCGAGGGCCGCAGG + Intronic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1052998358 9:34563873-34563895 CACTCTGAGTGGAGGGAGGCAGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061573605 9:131492642-131492664 AAGTCTGAGGAAAGAGACGCTGG - Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1198800061 X:140439454-140439476 GAGTCTGAGCCGAGAGGCGCGGG - Intergenic