ID: 1018095790

View in Genome Browser
Species Human (GRCh38)
Location 6:160386103-160386125
Sequence CACCTTGAGCACCTTGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018095787_1018095790 2 Left 1018095787 6:160386078-160386100 CCTGCACCTTCTGCAGAGCAGGG 0: 1
1: 0
2: 3
3: 36
4: 385
Right 1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG 0: 1
1: 0
2: 0
3: 21
4: 170
1018095785_1018095790 5 Left 1018095785 6:160386075-160386097 CCACCTGCACCTTCTGCAGAGCA 0: 1
1: 0
2: 6
3: 36
4: 377
Right 1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG 0: 1
1: 0
2: 0
3: 21
4: 170
1018095789_1018095790 -4 Left 1018095789 6:160386084-160386106 CCTTCTGCAGAGCAGGGTGCACC 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG 0: 1
1: 0
2: 0
3: 21
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018095790 Original CRISPR CACCTTGAGCACCTTGAGCA CGG Intronic
900437790 1:2639783-2639805 CACCTTGAGTACCTCGGGGATGG - Intronic
900795791 1:4707538-4707560 CACCTTGAAAACCCTGAGCAGGG - Intronic
900827293 1:4936979-4937001 CAGCTGCAGGACCTTGAGCAAGG + Intergenic
902616118 1:17624484-17624506 CACCTTGAGGAACTCGAGGAAGG - Exonic
903057241 1:20644738-20644760 CTCCATGTGCACCTTGATCAGGG + Intronic
903579013 1:24357293-24357315 CACCTGGAGCACCTACAGCATGG - Exonic
903890885 1:26569761-26569783 CACCTTCAGCACCCAGTGCAGGG - Intronic
904292777 1:29498386-29498408 GACCTTGACCACCTTGAGTGGGG + Intergenic
904333945 1:29785015-29785037 GACCTTGACCACCTTGAGTGGGG + Intergenic
904412490 1:30332852-30332874 GACCTTGACCACCTTGGGCGGGG - Intergenic
905011207 1:34748128-34748150 CACTTTTAGCACCTGGAGCCTGG - Intronic
906923935 1:50094210-50094232 CCACTTGAGCTCCTTGAGGATGG - Intronic
907300528 1:53483921-53483943 CACCTGGGCCCCCTTGAGCAGGG - Intergenic
914340960 1:146760137-146760159 AACCTTGAGGACCTTATGCAAGG + Intergenic
919738810 1:200970396-200970418 CACCTTCAGCCCCTTGGGAAGGG - Intronic
920183363 1:204146229-204146251 CACCTTCTGAACCATGAGCAGGG - Intronic
920310655 1:205046439-205046461 CACCCTGAACACCCTGACCAAGG + Intronic
920678618 1:208056205-208056227 CCCCTGGAGCTCCTTGAGCATGG - Intronic
920960906 1:210663295-210663317 TACCTTGAGCACCTGGAGTAGGG + Intronic
923234047 1:232015261-232015283 CACCGTGAGGCCCTGGAGCATGG - Intronic
1065726923 10:28676624-28676646 CACCTTGAGTACCTTGGGAAGGG + Intergenic
1068917759 10:62451323-62451345 CAAATTGAGCAACTTGAACAAGG - Intronic
1070288543 10:75100328-75100350 CACCCTGAGCATCGGGAGCAAGG - Intronic
1071733504 10:88272078-88272100 CACACTGACCACCTTGAGGAGGG - Intergenic
1072337986 10:94417156-94417178 CAACTTGAGAAACTGGAGCATGG + Intronic
1072420671 10:95288848-95288870 GACCATGAACACCTTGAGAATGG + Intronic
1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG + Exonic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1076212322 10:128658548-128658570 CACCTGGGGCACCTGGAGCATGG + Intergenic
1077336783 11:2008838-2008860 CACGTTGAGGACGTTGTGCATGG + Intergenic
1078072276 11:8123344-8123366 CACCTTGAGAAACTAGAGAAAGG + Intronic
1078512601 11:11996796-11996818 CACCTTGGCCCCCTTGTGCAGGG - Intronic
1079918845 11:26406265-26406287 CACCTTGAGCCCTTTGATAATGG + Intronic
1081884604 11:46484120-46484142 TACCTTGGGCCCCTTGTGCATGG - Intronic
1083119507 11:60497441-60497463 CACGCTGAGCACCCTGAGCTTGG - Exonic
1084968777 11:72758194-72758216 CACCTTGATCTCCCTGGGCAAGG - Intronic
1085303383 11:75471679-75471701 CTCTATGAACACCTTGAGCAAGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1090236699 11:125153507-125153529 TACCTTCAGCACCTGAAGCAGGG - Intergenic
1202819767 11_KI270721v1_random:64020-64042 CACGTTGAGGACGTTGTGCATGG + Intergenic
1096665010 12:53158655-53158677 CACCATGCGCTCCTTGAGCACGG + Exonic
1097582641 12:61477067-61477089 CACCCTGAGGACCTAGAACAAGG - Intergenic
1100404613 12:94262661-94262683 CCCCTTGAGCACCTGGTGGAGGG - Intronic
1101539790 12:105654403-105654425 CACTTTGAGCTTCTTGAGTATGG + Intergenic
1103506360 12:121444204-121444226 CATCTTCTGCTCCTTGAGCAGGG + Exonic
1103561438 12:121795054-121795076 CACTGTGAGAACCTTGACCATGG - Intronic
1104374516 12:128252073-128252095 CCCCTTCCTCACCTTGAGCAAGG + Intergenic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1113812092 13:113149174-113149196 CACCTCCAGCATCTTGAGCCTGG - Exonic
1113971192 13:114191148-114191170 CACCTAGAGGACCATGAGTATGG + Intergenic
1119408391 14:74412650-74412672 CCCCTTGAGCAGGTTGAGGAAGG + Intronic
1119969714 14:78956443-78956465 TAGCTTGAGCATCTGGAGCATGG + Intronic
1120759592 14:88273715-88273737 CACCTTTAGGGCCTTGATCATGG - Intronic
1121031307 14:90660900-90660922 GACCTTGAGCAAGGTGAGCACGG + Intronic
1122878947 14:104681382-104681404 CACCTTGGGGACCTTGGACACGG + Intergenic
1124375426 15:29126270-29126292 CACCTTGTGCACATCTAGCATGG - Exonic
1125008125 15:34840644-34840666 CACCTTGAACACCCTGGGCCAGG + Intergenic
1126544657 15:49860214-49860236 CACCGTGAGCAGCTTTAGCCAGG - Exonic
1129005286 15:72367740-72367762 CACCTTGAGTTCCTTGAATATGG + Intronic
1131110594 15:89762093-89762115 CACCTGGGGCACCTTGGCCAAGG - Intronic
1131370235 15:91874989-91875011 CAGCCTTAGCACCATGAGCAGGG - Intronic
1131370425 15:91876477-91876499 CAGCCTTAGCACCATGAGCAGGG + Intronic
1132699923 16:1217962-1217984 CACCTTCAGCAACTTCGGCATGG + Exonic
1135146184 16:19964801-19964823 CACCTTGAGGACATTGTGCTAGG - Intergenic
1135788463 16:25371899-25371921 CCCCAGGAGCAACTTGAGCAGGG - Intergenic
1136024753 16:27462291-27462313 CACCTGGAGCAACTCCAGCACGG + Exonic
1138193918 16:55038423-55038445 CCACTTGAGCCCCTTTAGCATGG - Intergenic
1139993325 16:70957269-70957291 AACCTTGAGGACCTTATGCAAGG - Intronic
1141130065 16:81430234-81430256 CACCATGCGCAGCCTGAGCACGG - Intergenic
1141154230 16:81585937-81585959 CTCCATGAGCTCCTGGAGCATGG + Intronic
1141173616 16:81705539-81705561 CAGGTTCAGCACCTGGAGCATGG - Exonic
1142941785 17:3386043-3386065 CGCCCTGAGCAACCTGAGCATGG + Intergenic
1149458943 17:56811643-56811665 CACAATGGGCACCTTGAGTAAGG + Intronic
1152134318 17:78494976-78494998 CACCCTGTACACCTTGTGCAAGG - Exonic
1155203058 18:23534427-23534449 CTCCGTGAGTACCCTGAGCAGGG - Exonic
1155313847 18:24551821-24551843 CACCTGGTGCATCTGGAGCACGG - Intergenic
1156882136 18:42093426-42093448 CACCTTGTTCACCATGAGGAGGG + Intergenic
1157424676 18:47574776-47574798 GACCGTGAGCTCCTTGAGAAAGG + Intergenic
1158398040 18:57095009-57095031 GAACTTGAGCCCTTTGAGCAGGG - Intergenic
1158942080 18:62413842-62413864 AGCCTTGATCACCTTGATCAAGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160701065 19:507658-507680 CGCCTCCAGCACCTTCAGCAGGG - Exonic
1161507514 19:4651875-4651897 CACCTTCAGCACCAAGAGCCTGG + Exonic
1162805966 19:13138252-13138274 AGCCTTGAGCACCTTGACCTTGG - Exonic
1164161578 19:22628675-22628697 CACCTTGAGCATGGTGAGGAGGG - Intergenic
1165342846 19:35224927-35224949 CAGCTTCAGCCCCTTGAGCACGG + Exonic
1166863829 19:45824443-45824465 CAGCTGGACCACCTTGAGAATGG + Intronic
926216979 2:10911987-10912009 CACCTCGAGCACCTCGCGGACGG + Exonic
928002579 2:27537763-27537785 CACCTCGAGCTCCTAGAGAATGG - Intronic
930012850 2:46950678-46950700 CCCCTTGAGCACTTGGAGTATGG + Intronic
933257833 2:80100670-80100692 CACCTGGAATACCTTGAGCTGGG - Intronic
935857646 2:107292498-107292520 CATCTAGAGCACCTTGCCCAAGG - Intergenic
937078933 2:119126650-119126672 CACGGTGAGCACCCTGGGCATGG + Intergenic
937426169 2:121800973-121800995 CAGCTTGAACACCCTGAGCGGGG - Intergenic
937911958 2:127080146-127080168 CACCAGGAGCTCCTTGAGGATGG - Intronic
944991208 2:205238185-205238207 CACATTAAACACCTTCAGCAGGG - Intronic
946313205 2:218894305-218894327 AACCTTGAGATCCTTAAGCAGGG + Intronic
947593783 2:231398825-231398847 CAGCTTGTGCACCACGAGCATGG - Exonic
948839235 2:240641045-240641067 CTGCCTGAGCACCTTCAGCAAGG - Intergenic
1169634084 20:7667434-7667456 CTACTTGAGCACCTAGAGCGTGG - Intergenic
1172098529 20:32472556-32472578 CACCGTGAGCACCTTCAAGAGGG + Intronic
1172183871 20:33019602-33019624 CACCTTGAGCACCACAGGCATGG - Exonic
1173256274 20:41396030-41396052 CACCGTGAGTGCCTTGGGCAGGG - Intergenic
1174342802 20:49908326-49908348 CACCTTGTGCAGGCTGAGCAGGG + Exonic
1174526428 20:51175724-51175746 CAGATTCAGCACATTGAGCAAGG + Intergenic
1174909836 20:54595362-54595384 CACTTTGATCACATTGTGCACGG + Intronic
1179831251 21:43998098-43998120 CACCTTGTGCTCCTAGACCAGGG + Intergenic
1180725458 22:17943582-17943604 AGCCTTGGGCACCTTGAGTAAGG - Intronic
1181405965 22:22685460-22685482 CTCCTAGAGCACCTTGACCTCGG - Intergenic
1181409766 22:22710723-22710745 AATCTTGAGCACCTTGTGCCGGG + Intergenic
1181419587 22:22788678-22788700 CTCCTAGAGCACCTTGACCTCGG - Intronic
1181426764 22:22848879-22848901 CTCCTAGAGCACCTTGACCTCGG - Intronic
1184067542 22:42129105-42129127 CACCTTGCGCAACTTGGGCCTGG - Exonic
1184070273 22:42142800-42142822 CACCTTGCGCAACTTGGGCCTGG - Intergenic
1184072014 22:42152419-42152441 CACCTTGCGCAACTTGGGCCTGG - Intergenic
1184125397 22:42483170-42483192 CTCCTTGAGCTCCTTGAGTAGGG - Intergenic
1184133881 22:42534668-42534690 CTCCTTGAGCTCCTTGAGTAGGG - Intergenic
950352114 3:12365449-12365471 AACCTAGATGACCTTGAGCACGG - Intronic
950586810 3:13898122-13898144 CACCAAGAGCACCTAGAGTAAGG - Intergenic
956464878 3:69509466-69509488 CACTTCCAGCACCTTGAGAAAGG - Intronic
957014497 3:75047216-75047238 GAGCTTGAGTCCCTTGAGCAGGG - Intergenic
957592052 3:82211793-82211815 CAACTGTAGCACATTGAGCATGG - Intergenic
959374956 3:105577927-105577949 GAACTTCAGCAACTTGAGCATGG - Intergenic
960823835 3:121761700-121761722 ATCCTGGAGCACCTAGAGCAAGG + Intergenic
961349977 3:126293642-126293664 CACCATGAGCACTTTCTGCAGGG - Intergenic
962626884 3:137234527-137234549 CACGTTGAGAACCTTCTGCAAGG + Intergenic
964675423 3:159273631-159273653 TACTTTGAGCTGCTTGAGCATGG + Intronic
964830671 3:160880780-160880802 GACTTTCAGCATCTTGAGCAGGG + Intronic
965750260 3:171968543-171968565 CACCTAGTGCAACTTGAGCTTGG + Intergenic
965783134 3:172309195-172309217 CACCTGGAGCACTTTGATCAGGG - Intronic
966912456 3:184567010-184567032 CAGGTCGAGGACCTTGAGCAGGG - Intronic
967727988 3:192879845-192879867 CAGCTTCAGCACCTTGCCCAAGG + Intronic
970575437 4:17422570-17422592 CTCCAGGAGCACCTGGAGCACGG - Intergenic
978852154 4:113352013-113352035 CACCTTCAGCAGCTTATGCATGG + Intronic
980332632 4:131429006-131429028 CACCCTGATCACCCTGATCATGG + Intergenic
981245654 4:142534395-142534417 AACCTTGAGCCCCTTGATAAGGG - Intronic
986954411 5:13133867-13133889 CACCTCCAGCAGCTTAAGCATGG + Intergenic
988739777 5:34058923-34058945 GACCTTGAGTCCCTTGAGTAGGG - Intronic
989289030 5:39740185-39740207 AACTTTCATCACCTTGAGCACGG - Intergenic
990126748 5:52528228-52528250 TACATTTAGCACCTTTAGCAGGG - Intergenic
991572828 5:68073725-68073747 CATCTCCAGCACCTAGAGCAGGG + Intergenic
994978035 5:106836351-106836373 CACCTTGAACAACTTCAGAATGG + Intergenic
996659125 5:125978882-125978904 CACCTTGTCCACCTGGAGCAAGG - Intergenic
999003664 5:147952200-147952222 CATCATAAGCACCTAGAGCATGG - Intergenic
1001015693 5:168139057-168139079 CTCCTTGGGAAGCTTGAGCAAGG - Intronic
1002167695 5:177358459-177358481 GACCTTGGGCACCTGGAGCAGGG - Intronic
1006380595 6:33695060-33695082 CTCCTTGAGCTCGTTGAGCTGGG - Exonic
1007512102 6:42381577-42381599 CACCTTGAGGACCAAGAGCAGGG + Intronic
1009940057 6:70280862-70280884 CACCTGCAGGACCCTGAGCAGGG + Exonic
1011260478 6:85465108-85465130 CACATTGAGCACCATGAATAAGG + Intronic
1013384661 6:109614192-109614214 CAACTTTAGCAGCTTGATCATGG + Exonic
1016446334 6:144136643-144136665 GAATATGAGCACCTTGAGCAAGG + Intergenic
1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG + Intergenic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1018636427 6:165863179-165863201 AACCTAGACCACCTGGAGCAAGG - Intronic
1018714746 6:166523345-166523367 CACCTTAAGTACCATGAGCAGGG + Intronic
1019172206 6:170138932-170138954 GCCCTTGAGCACCTGGAGAACGG + Intergenic
1023638257 7:42235442-42235464 CAGCTTGAGCGCATTGGGCATGG - Intronic
1023673637 7:42606494-42606516 TTTCTTGAGCAACTTGAGCATGG + Intergenic
1024100981 7:46032655-46032677 TAACTTGTGCATCTTGAGCACGG + Intergenic
1029337456 7:99914616-99914638 CACCTGGAGGACCAAGAGCAAGG - Intronic
1030667978 7:112302676-112302698 CACTTTGAGCATCTTCAACAAGG + Intronic
1031273323 7:119683883-119683905 CACATTGAGCACTTTCAGTATGG - Intergenic
1032997389 7:137463247-137463269 CACCTTGAGCCCCTTGCACGTGG - Intronic
1034489485 7:151385727-151385749 CACTGTGAGCCCCATGAGCAGGG - Intronic
1035635254 8:1139393-1139415 CACCTGCTGCACCTTGATCACGG - Intergenic
1035740436 8:1924168-1924190 CGCCTTGAGCACCTGGCTCACGG - Intronic
1041110335 8:54477231-54477253 CAGCCTGAGCAGCTGGAGCAGGG + Intergenic
1041213763 8:55579401-55579423 CACCATGAACACCGAGAGCAGGG - Intergenic
1042388563 8:68205444-68205466 CACCTTATTCACCCTGAGCAAGG - Intronic
1047390423 8:124446259-124446281 CAGCCTGGGCAACTTGAGCAAGG - Intergenic
1047861621 8:128973243-128973265 CACCTTGAGCACCTTGATGGTGG + Intergenic
1050767151 9:9149126-9149148 CACCTGGATAACCTTGAGCAAGG + Intronic
1050819751 9:9863600-9863622 AAACTTGAGCCCATTGAGCAAGG + Intronic
1052374610 9:27704661-27704683 CACATTAAACAGCTTGAGCAAGG + Intergenic
1053015510 9:34659854-34659876 CACCTGGAGCACCTGGAGCCCGG + Exonic
1055141955 9:72886582-72886604 CAGCATGGGCACCTTGAGCCTGG - Intergenic
1056787134 9:89601321-89601343 CACCTTGGTAACCTTCAGCAGGG - Intergenic
1058763777 9:108161916-108161938 CACCTTGAAAACCTTGACAATGG + Intergenic
1060984161 9:127810087-127810109 CACCTGCAGCAGCTTCAGCAGGG - Exonic
1061753456 9:132796871-132796893 CACCCTGGGCTCCATGAGCAAGG - Intronic
1061849345 9:133405291-133405313 CTCCTTGATCTCCTGGAGCAGGG - Exonic
1061942443 9:133891118-133891140 CTTGCTGAGCACCTTGAGCAGGG - Intronic
1062411648 9:136428808-136428830 CACCTTGAACACCTAGGCCAGGG - Exonic
1062539381 9:137034854-137034876 CTCCTTGAGGACCCTGGGCAGGG + Exonic
1193534930 X:82702587-82702609 CACTTAGAAAACCTTGAGCATGG - Intergenic
1193977242 X:88136685-88136707 CACAATGATCACCTTGAGTACGG - Intergenic
1197183486 X:123562128-123562150 CATCATGAACACCTTCAGCATGG + Intergenic
1197705270 X:129630258-129630280 AACCTGGAGCACCTTGAGACTGG + Intergenic
1199904029 X:152206548-152206570 CACCTTCAGCACAGTGAGCCAGG + Intronic
1200884144 Y:8252274-8252296 CACCTTGAGCACCTTGTTTCTGG - Intergenic
1201074650 Y:10177937-10177959 CAGCTTGAGGGCCTCGAGCATGG + Intergenic