ID: 1018099933

View in Genome Browser
Species Human (GRCh38)
Location 6:160428369-160428391
Sequence CTGGTCACCTGCAGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018099933_1018099936 -3 Left 1018099933 6:160428369-160428391 CCACCTGGGCTGCAGGTGACCAG 0: 1
1: 0
2: 2
3: 33
4: 286
Right 1018099936 6:160428389-160428411 CAGACTCGCTCAGTGCAGCACGG 0: 1
1: 0
2: 0
3: 1
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018099933 Original CRISPR CTGGTCACCTGCAGCCCAGG TGG (reversed) Intronic
900334247 1:2153627-2153649 CTGGCCAGCGGCAGCACAGGAGG + Intronic
900344152 1:2203212-2203234 CCCTTCGCCTGCAGCCCAGGTGG + Intronic
900408647 1:2503246-2503268 CAGGTCGCCAGCCGCCCAGGAGG - Intronic
900760579 1:4467549-4467571 ATGATCACCCCCAGCCCAGGAGG + Intergenic
900824000 1:4911772-4911794 CTGGTCATCTGCAAGCCAAGAGG - Intergenic
900940417 1:5795106-5795128 CTGGGCACCTGCAGGGCTGGCGG - Intergenic
901239460 1:7684508-7684530 CTGGCCACTTGCAGCTCTGGTGG + Intronic
902384383 1:16068095-16068117 CAGGGCACCTGCAGCCGATGCGG + Intronic
903211934 1:21823516-21823538 GTGGGCTCCAGCAGCCCAGGAGG + Exonic
903389541 1:22954128-22954150 CTGCTCCCCTGCATCCCAGGTGG + Intronic
904462063 1:30686103-30686125 CTCCTCACCTGCAGCCGAGCGGG + Intergenic
905472358 1:38203085-38203107 CTGGAGACCTGTAGCCAAGGAGG + Intergenic
907260849 1:53217414-53217436 CTGGCCACCTGCCCCCCAAGAGG - Intronic
908317914 1:62952296-62952318 CAGGTCTCCTGCAGCACATGTGG + Intergenic
908326560 1:63029110-63029132 CTGCTCACCTGCACCCCAGCTGG - Intergenic
910657627 1:89633831-89633853 GTGCTCACCTGCAGGACAGGAGG + Intronic
913328095 1:117645213-117645235 CTGTTATCCTGCAGCTCAGGGGG + Intergenic
913986540 1:143570807-143570829 CTGCTCATCTGCAGCACAAGTGG - Intergenic
914582293 1:149029978-149030000 CTGCTCATCTGCAGCACAAGTGG - Intronic
915118815 1:153616071-153616093 CTTGGCTCCTGAAGCCCAGGCGG - Intronic
915355693 1:155254357-155254379 CTGGGCACCTGCCTCCCAGTGGG + Intronic
915459449 1:156061118-156061140 CTGGAGACCTGGGGCCCAGGTGG - Intergenic
915489440 1:156243050-156243072 CGGATCCCCTGGAGCCCAGGAGG + Exonic
915537355 1:156545005-156545027 TTAGTGACCTGCTGCCCAGGTGG - Intronic
917443913 1:175090880-175090902 CTGGACACTAGCAGCCCTGGTGG - Intronic
918233925 1:182560547-182560569 CTAATGACCTGCAGCCCTGGAGG - Exonic
919879718 1:201893612-201893634 CTGGGATCCTGCAGCCCAGCTGG + Intergenic
920949158 1:210556470-210556492 CTGCTCACCTGAACCCCAGGGGG + Intronic
922952730 1:229572844-229572866 GTGTGCACCTGTAGCCCAGGAGG + Intergenic
924379267 1:243446789-243446811 CAGGTGACCTGCTGCCCAGTTGG + Intronic
924772538 1:247089731-247089753 CTGGCAGCCTGGAGCCCAGGAGG + Intergenic
924908129 1:248479422-248479444 CTGCTCAACTGCAGTCCTGGAGG - Intergenic
924915976 1:248568662-248568684 CTGCTCAACTGCAGTCCTGGAGG + Intergenic
1062763327 10:44221-44243 CTGGACCCCTGTACCCCAGGAGG - Intergenic
1063339760 10:5252310-5252332 CTGCTCTGCTGTAGCCCAGGAGG + Intergenic
1063524335 10:6770461-6770483 TTTGACACCTGGAGCCCAGGTGG - Intergenic
1066488764 10:35873987-35874009 CTGCTGACCTGCAGCCTCGGGGG + Intergenic
1067308838 10:45093279-45093301 CTGCTGACCTGCAGCCTCGGGGG + Intergenic
1067957264 10:50806098-50806120 CCTGTCCCCTGCAGCCCATGGGG - Exonic
1069927411 10:71860402-71860424 CTGATCACCCACAGCCCAGCGGG - Intergenic
1070307052 10:75245915-75245937 CTGAGCACCTGCCTCCCAGGAGG + Intergenic
1070522818 10:77269316-77269338 CTTGTAACCTACAGCCCAAGTGG - Intronic
1070772755 10:79091913-79091935 CAGGTCTCCTCCAACCCAGGTGG - Intronic
1070781968 10:79142849-79142871 CAGGTCACATGCTGCCCATGGGG + Intronic
1071816688 10:89239536-89239558 CAGGTCACCTGCTCCCCAGCAGG - Intronic
1073610848 10:104941257-104941279 CTGTTGAGCTGCATCCCAGGAGG - Intronic
1075568186 10:123519920-123519942 GTGGACACCAGCAGCCTAGGGGG + Intergenic
1076426755 10:130372496-130372518 CGTGTCATCTGCAGCCAAGGCGG + Intergenic
1076461115 10:130648162-130648184 CTGGTCACCCTCAGCTCAGGTGG + Intergenic
1076568137 10:131412756-131412778 CTGGAAATCTGCAACCCAGGTGG - Intergenic
1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG + Intronic
1076945732 10:133648516-133648538 CTGCTCACAAGCAGGCCAGGTGG + Intergenic
1077048663 11:556972-556994 CTGAACACCAGCAGCTCAGGGGG - Exonic
1077130502 11:969875-969897 CTGGGCAGGTGCAGCCCAGCTGG - Intronic
1077266863 11:1655240-1655262 CGGGCCACCTGGAGCACAGGGGG + Intergenic
1077465506 11:2731959-2731981 CTGGTCCCCTGCTGGCAAGGCGG - Intronic
1081811059 11:45914354-45914376 ATGGTCTCCTGCAGCCCCAGGGG + Exonic
1081978402 11:47250319-47250341 AGGATCACCTTCAGCCCAGGAGG + Intronic
1082787269 11:57324124-57324146 CTGGGCAGCTCCAGCCCCGGAGG + Intronic
1083143251 11:60738887-60738909 CTGTTCACCTGCAGGAGAGGAGG - Exonic
1083579818 11:63817909-63817931 CTGGTGGGCAGCAGCCCAGGAGG + Exonic
1083755171 11:64788353-64788375 TTGGGCAGCTGCAGCCCAGGAGG - Intergenic
1083887054 11:65578002-65578024 ATGTTCAACTGCTGCCCAGGAGG - Intronic
1084050201 11:66594386-66594408 CAGGTCACCTCCAGACCAGCTGG - Intronic
1084267046 11:68010462-68010484 CGGGTTACAGGCAGCCCAGGCGG + Intronic
1088231577 11:107678511-107678533 CTGGTCAGCGCCAGCCCAGGGGG - Intergenic
1088740393 11:112762340-112762362 CAGGTCCCATGCAGCCCTGGAGG + Intergenic
1091312408 11:134584142-134584164 CCCGTGACCTGCAGCCCAGCAGG + Intergenic
1091385708 12:93327-93349 ATGGTCCCCTGCCTCCCAGGTGG + Intronic
1091800820 12:3323504-3323526 GTGGTCTCCTGCAGGTCAGGGGG - Intergenic
1092154494 12:6273694-6273716 CTGCCCACCAGCAGCCCAGCAGG + Intergenic
1092745873 12:11672078-11672100 CTTGTCACCTGCACTCCAGTGGG + Intronic
1096262638 12:50102738-50102760 CTGGCCAGCAACAGCCCAGGGGG + Intergenic
1099710246 12:86214576-86214598 CTGGCCACCTGCAAACCAAGAGG - Intronic
1101781756 12:107844178-107844200 GTCGTCACCTGCACTCCAGGCGG + Intergenic
1102045038 12:109824427-109824449 CTACTCAGCTCCAGCCCAGGAGG + Intronic
1104813088 12:131629858-131629880 CTGGGCACCTGCAGCTCACCGGG + Intergenic
1105512099 13:21060537-21060559 CTGGCCGCCCGCAGCCCGGGAGG + Intronic
1105770853 13:23610527-23610549 CTGCCATCCTGCAGCCCAGGAGG + Intronic
1105950530 13:25225667-25225689 CTGGCTACCTGCATCCCAGGAGG - Intergenic
1106175799 13:27330180-27330202 CTGCTCACCTGCAACACACGTGG - Intergenic
1107740567 13:43445778-43445800 CTGATGACCTGCATCCCAGGAGG - Intronic
1108589762 13:51902670-51902692 CAGGTCACTTGCAGCCCTGATGG + Intergenic
1109744322 13:66602276-66602298 TGGGCCACATGCAGCCCAGGAGG - Intronic
1112534702 13:100241028-100241050 CAAGTTACCTGCAGGCCAGGGGG - Intronic
1112908961 13:104458628-104458650 CTGGGCAGCAGCAGCCCAAGGGG - Intergenic
1113422168 13:110179273-110179295 CTGATCCCCTGAAGCCCAGGGGG + Exonic
1113611246 13:111646178-111646200 CAGCTCACCTGCAGTCAAGGAGG - Intronic
1113884829 13:113653049-113653071 CTACTCTCCAGCAGCCCAGGAGG - Exonic
1113936897 13:113999660-113999682 CTGGTCCCCTGCAGCAGAGATGG + Exonic
1114181218 14:20369510-20369532 CTGGCCAAATGCAGCCCAGAAGG - Exonic
1117329265 14:54696138-54696160 CTGGTCACCTCTAGCTCAAGAGG + Intronic
1118731298 14:68668790-68668812 CTTGTCACCTTCAGCACAGCAGG - Intronic
1121332314 14:93057436-93057458 CTACTCACTTGCTGCCCAGGGGG + Intronic
1122267618 14:100554058-100554080 CTGCTCCCCTGAAGCCCATGGGG + Intronic
1122352256 14:101103029-101103051 CTTGCCACCTGCAGCCCATCTGG - Intergenic
1122540691 14:102496246-102496268 CTGGTCACCAGCAGTGCTGGTGG - Intronic
1123015170 14:105370067-105370089 CGGGTGACCTGGAGCCCGGGAGG - Intronic
1202919837 14_KI270723v1_random:21109-21131 CTGCTCACAAGCAGGCCAGGTGG + Intergenic
1202925080 14_KI270724v1_random:16529-16551 CTGCTCACAAGCAGGCCAGGTGG - Intergenic
1123948640 15:25251003-25251025 CTGGACACCTGCAGGCCCTGAGG + Intergenic
1124004237 15:25783825-25783847 TCGGTCACCTGCAGGCCATGTGG + Intronic
1127398282 15:58561187-58561209 CTGGTGACCTGTATCCAAGGTGG + Intronic
1129165728 15:73776194-73776216 CTAGGGAGCTGCAGCCCAGGGGG + Intergenic
1129470297 15:75750031-75750053 CTGGGCACCCCCAGCCCAGAGGG + Intergenic
1130098003 15:80870520-80870542 CTTGTCACCTGCAGAGCAAGGGG - Intronic
1130181514 15:81634031-81634053 CTGGCCACCTCCAGCTCTGGTGG - Intergenic
1130883947 15:88077974-88077996 CTGGATCCCTGTAGCCCAGGAGG - Intronic
1130909774 15:88263027-88263049 CTTGGTCCCTGCAGCCCAGGGGG - Intergenic
1132420734 15:101665131-101665153 CAGGTCACCTGCGTCCCAGAAGG + Intronic
1132596752 16:754923-754945 CTGCTCACCGGCAGCACACGGGG + Intronic
1132602799 16:781509-781531 CCGGGCCCCAGCAGCCCAGGAGG - Intronic
1132700357 16:1219672-1219694 CTGGACATCAGCAGCCCAGCTGG - Intronic
1132746832 16:1439682-1439704 CTGGCCTCCTGCCCCCCAGGAGG + Intronic
1132749758 16:1452100-1452122 CTGGGCTCCAGCAGCACAGGGGG + Intronic
1132888768 16:2194278-2194300 CTGGCCTCCTGCTGGCCAGGAGG - Intronic
1133462317 16:5997606-5997628 TTTATCACCTGCAACCCAGGAGG - Intergenic
1134836470 16:17365351-17365373 CTGGGCACGTGCAGGGCAGGCGG + Intronic
1135040799 16:19115284-19115306 CGGGTCACCTTGACCCCAGGTGG + Exonic
1136398684 16:30006328-30006350 CTGCCCACCTGCTCCCCAGGTGG - Exonic
1141034960 16:80618721-80618743 CTGGACAGCTGCAGGCAAGGTGG - Intronic
1141425717 16:83943298-83943320 CAGGTCCCCTGCATACCAGGAGG - Intronic
1141431679 16:83973416-83973438 CTGGCCTCCTGCATCCCTGGGGG + Intronic
1141503846 16:84462195-84462217 GTGGGGAGCTGCAGCCCAGGAGG + Intronic
1141616850 16:85214714-85214736 CTAGTCGCCTGCACCCCACGCGG - Intergenic
1141729160 16:85810257-85810279 CTGGTCACCCGCATGCCATGGGG + Intergenic
1141871799 16:86791652-86791674 CTGGTAACCTGAAGGCCACGTGG + Intergenic
1141995885 16:87636114-87636136 CTGGTCACCTGCAGAACAGGCGG - Intronic
1142311866 16:89318836-89318858 CTGCTCACCTGCACCGCGGGTGG - Intronic
1143559728 17:7686410-7686432 CGGGTCGCCTGCAACCTAGGCGG - Exonic
1144494357 17:15737192-15737214 GGTGTCACCTCCAGCCCAGGTGG + Intronic
1144834209 17:18148481-18148503 CTGGTCACCTGGGGCGCAGCAGG - Exonic
1144905908 17:18639484-18639506 GGTGTCACCTCCAGCCCAGGTGG - Intronic
1145766765 17:27463610-27463632 GTGGTTACCTGCAGCAAAGGGGG + Intronic
1145909716 17:28535309-28535331 CTGGTCAACTGAAGCAGAGGAGG + Intronic
1146635102 17:34498109-34498131 GTGGTCACCTGGAGCCAATGAGG + Intergenic
1147057159 17:37843623-37843645 CTGGCCACCTGCTGCTCATGAGG + Intergenic
1147241569 17:39094123-39094145 AGGGGCACCTGCAGCACAGGTGG - Intronic
1147436028 17:40416237-40416259 CTGGTTTCCTGGAGCCCAGGAGG - Intronic
1148796025 17:50197172-50197194 CTGCTCACCTGAGGCCCAGGAGG + Exonic
1151153092 17:72104720-72104742 CTGTTTCTCTGCAGCCCAGGTGG - Intergenic
1152542273 17:80982305-80982327 CTGGTCAGCTGCAGCCATGGTGG - Intergenic
1152572703 17:81127563-81127585 CTGGTGAGCTGCTGCCCGGGGGG - Exonic
1152630801 17:81409974-81409996 CGGGGCAGCTGCAGCCAAGGTGG - Intronic
1152956237 18:44552-44574 CTGGACCCCTGTACCCCAGGAGG - Intergenic
1152961048 18:80332-80354 CTGTTCACCTGTGGCCCAGCGGG - Intergenic
1156365151 18:36419332-36419354 CTGGCCACCAGCTGTCCAGGAGG - Intronic
1156381140 18:36562562-36562584 CTGGTCCGCTTCAGCCCAGCAGG - Intronic
1157272446 18:46286815-46286837 GTAGTCGTCTGCAGCCCAGGAGG - Intergenic
1157403557 18:47405608-47405630 CTGGGCACCTGCAGTTCAGCAGG - Intergenic
1157572316 18:48721241-48721263 CTAGTTACCTGCAGGACAGGAGG + Intronic
1158458148 18:57625253-57625275 CTGGTCAGCTGCAGCCAATGGGG + Intergenic
1158670411 18:59469032-59469054 CTGCTCAGCTGCAGCCCAGGTGG + Intronic
1161769713 19:6224490-6224512 CTGAGCTCCTGCAGCCCAGCTGG - Intronic
1162020242 19:7864920-7864942 CTGTTCACATGTCGCCCAGGCGG + Intronic
1162034552 19:7932028-7932050 CTGGACACCTTCGGCCCAGTCGG - Intronic
1163315182 19:16536409-16536431 CTGGTCACATTTAGACCAGGCGG - Intronic
1163641843 19:18466538-18466560 CTGTGCCCCTGCAGCCCAGCTGG + Intronic
1163697452 19:18771264-18771286 CTGGACACCTGCAGGAAAGGTGG - Intronic
1164462851 19:28463657-28463679 CTGGTCTGCTTCACCCCAGGAGG + Intergenic
1164796339 19:31035868-31035890 TTGCTCACCTGCACCACAGGAGG + Intergenic
1165283299 19:34816088-34816110 CTGGCCAGCTGCATTCCAGGTGG - Intergenic
1166073299 19:40398809-40398831 CTGGTCCCCTGCGGGCGAGGTGG + Exonic
1166960918 19:46495380-46495402 CTGGTCACCGGCATCCCGGAGGG - Exonic
925407047 2:3612786-3612808 CTGGTCACAGGCAGCCCCCGTGG + Intronic
927198522 2:20564375-20564397 CTGGTCACCAGCAGCCCTGAGGG - Intronic
928253992 2:29706244-29706266 CTGGTCAGCAGGAACCCAGGGGG + Intronic
929117401 2:38456052-38456074 CTGGTCACCAGCTGCCAAGCTGG + Intergenic
933158952 2:79003079-79003101 ATGGTGACCAGCAGCCCAGAGGG + Intergenic
935229942 2:101087140-101087162 CTGGTTGCGTGCGGCCCAGGAGG - Intronic
936480254 2:112879234-112879256 CAGATCACCAGCAGCCCATGGGG - Intergenic
937450995 2:122001891-122001913 CTGGTAAGCTGCAACCCAGAAGG + Intergenic
937984819 2:127633665-127633687 CTGCTCTCCTGCACCCCAGATGG - Intronic
943356009 2:186856812-186856834 TGGGCCACATGCAGCCCAGGTGG - Intergenic
943670274 2:190652927-190652949 GTGGTTGCATGCAGCCCAGGAGG + Intronic
944194867 2:197041738-197041760 CAGATCACCTGCAGCCCAACAGG + Intronic
945868778 2:215204688-215204710 CTGATGACATGCAGCCAAGGCGG - Intergenic
947407398 2:229793775-229793797 CAGGCCACATGCAGCCCAGATGG + Intronic
947714911 2:232334550-232334572 CTGGGCACCTGCTCACCAGGAGG + Intronic
947733986 2:232445501-232445523 CTGGGCACCTGCTCACCAGGAGG + Intergenic
948406805 2:237727678-237727700 CTGCTCCCCCGCAGCTCAGGAGG - Intronic
949073245 2:242039293-242039315 CTGGGCACCTGCAGGCCCTGGGG - Intergenic
1168765874 20:381377-381399 CGCGTCACCTGAAGCCCGGGGGG - Intronic
1169204683 20:3732984-3733006 GTGGTCCCCCGAAGCCCAGGTGG - Intronic
1169451436 20:5715266-5715288 CAGTTCACCTGCAGCCAGGGAGG + Intergenic
1169486974 20:6042036-6042058 CTGGTCTCCCGCAGGCCGGGTGG + Exonic
1170547107 20:17443756-17443778 CTTTTCACCTGCAGCCAGGGAGG - Intronic
1171088353 20:22260659-22260681 GTGGTCACCAGCAGCAAAGGAGG - Intergenic
1171459459 20:25290741-25290763 CTGCTCGCCTGCAGCCCGGCTGG - Intronic
1173328941 20:42058319-42058341 CTGGGTCCCTGGAGCCCAGGTGG + Intergenic
1174169456 20:48606998-48607020 CTGGGCTCCCCCAGCCCAGGTGG - Intergenic
1175863201 20:62161084-62161106 CTGGTCACCTGCGCCCGAGGGGG + Intronic
1175909249 20:62396812-62396834 CTGGGGACCAGCAGCCCTGGGGG + Intronic
1176121735 20:63457166-63457188 CTTGTCCCCTCCAGCCCCGGCGG - Intronic
1177243973 21:18498220-18498242 GTGGCCATCTGCAACCCAGGAGG - Intergenic
1178204187 21:30444019-30444041 GTGGTCATCTGCAAACCAGGAGG + Intergenic
1179920803 21:44506355-44506377 CTGCTGACATGCAGGCCAGGCGG + Intronic
1181711639 22:24695278-24695300 CCTGTCACCTGCGGCCCAGGTGG - Intergenic
1183060629 22:35334469-35334491 CTGGTCCCCTGCAGTTCGGGTGG + Intronic
1183728485 22:39603064-39603086 CTGGGCTCCTTGAGCCCAGGAGG + Intronic
1184864753 22:47195891-47195913 CCTGTGTCCTGCAGCCCAGGGGG - Intergenic
1185121672 22:48975132-48975154 CAGGCCACCTGCAGCCCATGAGG + Intergenic
949889585 3:8723827-8723849 GTGGTTTCCTGCAGCCAAGGGGG - Intronic
950417731 3:12877919-12877941 ATGGTCACGGGCAGCACAGGTGG - Intergenic
950495148 3:13329243-13329265 CTGGACATTTGCAGCCCAGGGGG - Intronic
950521890 3:13502280-13502302 CTGGCCACCTGCCCCTCAGGCGG + Intronic
950534373 3:13570807-13570829 CTGTTCACCTGCCGCCCTGCCGG + Exonic
953880281 3:46687773-46687795 CTAGTCAGCTGCAGCCCTGAGGG + Intronic
954387505 3:50252010-50252032 CCAGACACCTGTAGCCCAGGAGG - Intronic
954807466 3:53228911-53228933 CTGGTCACTTGCTGCCCCAGGGG - Intronic
955063241 3:55512719-55512741 CTTGTGACCTGCTGCCCAGCTGG - Intronic
957081748 3:75641954-75641976 CTGCTCACAAGCAGGCCAGGTGG - Intergenic
964489267 3:157217596-157217618 CTTGCCACCTGCACTCCAGGTGG + Intergenic
968358097 3:198123689-198123711 CTGGACACCTGTACCCCAGGAGG + Intergenic
968516191 4:1016632-1016654 CTGGGGGCCTGCAGCACAGGTGG - Intronic
968700966 4:2058336-2058358 GAGGTCACCTGAAGGCCAGGAGG - Intergenic
968908338 4:3464515-3464537 CAGGTCCCCTGCAGCCCCGGAGG - Intronic
969301956 4:6302288-6302310 CAGGCCACTTGCTGCCCAGGCGG - Exonic
969506818 4:7593346-7593368 CAGGTCACCTGCAGCAGAGCAGG + Intronic
971855752 4:32041267-32041289 GTGGCCACCTGCAAGCCAGGAGG + Intergenic
976390110 4:84498017-84498039 CTGGGCACCCACAACCCAGGCGG - Exonic
985440358 4:189979395-189979417 CTGGACCCCTGCACCCCAGGAGG - Intergenic
985449121 4:190049027-190049049 CTGCTCACAAGCAGGCCAGGTGG + Intergenic
985716687 5:1466993-1467015 CTGGGCACCTGCAGGGCCGGCGG + Intronic
989332747 5:40278846-40278868 CTGGACACCTGCAGCACTGCTGG + Intergenic
990261461 5:54027687-54027709 CTGGCCATCTGCAGCACACGGGG + Intronic
990372566 5:55135672-55135694 CAGGGCACATGCAGCCCAGGAGG + Intronic
990460844 5:56029597-56029619 GGGGTCACCTGCAAGCCAGGAGG + Intergenic
991626242 5:68603981-68604003 CTGGGAAGCCGCAGCCCAGGTGG + Intergenic
992089904 5:73307488-73307510 CCTGTCACCCCCAGCCCAGGGGG - Intergenic
995592139 5:113710110-113710132 CAGGACACCTACAGCCAAGGAGG + Intergenic
996750139 5:126879951-126879973 CTGGCCACTTGCAGCCCAAGTGG + Intronic
999130124 5:149276091-149276113 CAGGTCACCTGCCACCAAGGAGG - Intronic
1001037901 5:168311123-168311145 CTGGTGAGCTGCAGTCCAGCAGG - Intronic
1001449327 5:171812181-171812203 ATGGTCATCAGCAGCCCAGAGGG - Intergenic
1001986360 5:176076727-176076749 CTGGAGCCCTGCAGCCGAGGGGG + Intronic
1002134339 5:177098623-177098645 AGGGACAGCTGCAGCCCAGGCGG - Intergenic
1002230507 5:177761397-177761419 CTGGAGCCCTGCAGCCGAGGGGG - Intronic
1002264829 5:178022351-178022373 CTGGAGCCCTGCAGCCGAGGGGG + Intronic
1002770473 6:286467-286489 CTCCTCACCTGCAGACCAAGTGG + Intergenic
1002823882 6:755174-755196 ATGGTCACCTGGAGTCAAGGAGG + Intergenic
1003146334 6:3513408-3513430 CTGTGTACCTGCAGCCCAGGTGG - Intergenic
1003153340 6:3571173-3571195 TGGGCCACCTGCTGCCCAGGAGG - Intergenic
1004101163 6:12613244-12613266 CAGGTCACCAACAGCCCAGTGGG - Intergenic
1006606197 6:35259556-35259578 CGGGGCTCCTGGAGCCCAGGCGG - Intronic
1006925883 6:37654929-37654951 GTGGTCCACTGCTGCCCAGGGGG - Exonic
1007115992 6:39343662-39343684 TTGGTGACCTGCTGCCCAGGAGG + Intronic
1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG + Intronic
1010863065 6:80937569-80937591 CAGCTCTCCTGCAGCCCAAGAGG + Intergenic
1014231475 6:118907596-118907618 GTGGTCACATGCAGTCCATGTGG - Exonic
1015508896 6:134017977-134017999 TAGGTCACCTGCAGTCCAGAGGG - Intronic
1016371019 6:143374228-143374250 CTGGTGGCCTGCAGGACAGGTGG + Intergenic
1017615682 6:156244140-156244162 CTGGTCCTCTGGAGCCCAGGAGG - Intergenic
1017750680 6:157488025-157488047 CTACTCACATGCAGCCCAGGTGG + Intronic
1017908675 6:158774067-158774089 CGGGTCATCTTCACCCCAGGCGG - Intronic
1018062444 6:160101625-160101647 CTTATCACCAGCAGCACAGGAGG + Intronic
1018099933 6:160428369-160428391 CTGGTCACCTGCAGCCCAGGTGG - Intronic
1018328689 6:162704182-162704204 ATAGTCCCCTGCTGCCCAGGTGG - Intronic
1018384668 6:163291472-163291494 CGGGGCATCTGCAGCCCACGGGG + Intronic
1018934579 6:168265416-168265438 CTGGTCTGCTGATGCCCAGGGGG - Intergenic
1019346592 7:533801-533823 CCGGGCACCTGCGGCTCAGGGGG - Intergenic
1019351683 7:557010-557032 CTGGTTCTCTGCAGCTCAGGAGG - Intronic
1019494083 7:1329535-1329557 CTGGGCACCTGCCCCCCAGAGGG + Intergenic
1019586091 7:1804493-1804515 CTGCGCGGCTGCAGCCCAGGAGG - Intergenic
1021135878 7:16964689-16964711 CTGGTCACCTTCCACACAGGAGG + Intergenic
1023026634 7:36056651-36056673 TGGGTCACCTGCAGCACTGGAGG - Intergenic
1023116608 7:36868905-36868927 CTGCTCAGCTTCAGCCGAGGAGG - Intronic
1023840678 7:44095993-44096015 CTGGGCACCTGCAGCCACGCAGG + Intergenic
1024619316 7:51144112-51144134 CAGCTCACATGCCGCCCAGGTGG - Intronic
1029283692 7:99452345-99452367 CTGGTCACCAGCAGCCAGAGGGG - Intronic
1029976874 7:104843173-104843195 CTGGGAGCCTGCAGCCCAGCTGG + Intronic
1030087229 7:105826993-105827015 CTGGACACCTGTAGTTCAGGTGG - Intronic
1030090344 7:105852518-105852540 CTGGTCAGATGCAGCACAGGGGG + Intronic
1032191755 7:129769778-129769800 TGGGCCACCTGCACCCCAGGGGG + Intergenic
1032478387 7:132227475-132227497 CTACTCCCCTGCAGCCAAGGAGG - Exonic
1033607866 7:142940597-142940619 GTTGTGACCTGGAGCCCAGGAGG - Exonic
1034268487 7:149792291-149792313 CTGGGCACCAGCAGCCTAGAGGG - Intergenic
1034443748 7:151101311-151101333 CCTGTCCCCTCCAGCCCAGGAGG - Intronic
1034491607 7:151395984-151396006 CTGGTGACCGGCAGCACAGATGG - Exonic
1035233918 7:157484230-157484252 CTGCTCACCTCCAGCCAAGTTGG + Intergenic
1035300928 7:157896767-157896789 CTGGGCAGCTCCAGCCCAAGTGG - Intronic
1035584191 8:759400-759422 CTGGAAACGTGCAGCCCAGGGGG - Intergenic
1035584242 8:759593-759615 CCGGGAACGTGCAGCCCAGGGGG - Intergenic
1037123706 8:15319680-15319702 CTGGTGGCCTGCAGCACAGGTGG + Intergenic
1037337113 8:17801773-17801795 CTGGCCACCTGCAGGCCGAGGGG + Intergenic
1038537797 8:28366687-28366709 ATGGTGACCTGCAAACCAGGAGG - Intronic
1039376701 8:37041702-37041724 CTCCTCTCCTGTAGCCCAGGAGG - Intergenic
1039847259 8:41334340-41334362 CTAGTCATCTGCAACCCTGGAGG - Intergenic
1040626613 8:49157180-49157202 GTGGTTATCTGAAGCCCAGGGGG + Intergenic
1042181066 8:66088140-66088162 CTGGTCTTCTGCACACCAGGAGG + Intronic
1042484725 8:69337151-69337173 CTGGGCACCTGCAGGCCCTGGGG - Intergenic
1042877150 8:73449778-73449800 CTGGACTCCTGAGGCCCAGGAGG + Intronic
1048396612 8:134020075-134020097 CTGCTCTTCTGGAGCCCAGGTGG - Intergenic
1049103474 8:140596761-140596783 CGGGTCACCTGCAGGCTGGGAGG + Intronic
1049103510 8:140596913-140596935 CTGGTGCCCACCAGCCCAGGGGG + Intronic
1049269184 8:141685099-141685121 CTGGTCCCATGCAGGCCAGCAGG - Intergenic
1049406866 8:142455503-142455525 CTGGTCCCCTGCAGCCCACCAGG + Intronic
1049767361 8:144361078-144361100 CTGAGTGCCTGCAGCCCAGGAGG + Exonic
1052816776 9:33107768-33107790 CTGGTCCCTTGGAGCCCATGGGG + Intronic
1056534705 9:87517245-87517267 CTGACCACCTGCACCCCCGGAGG - Intronic
1058010366 9:99970101-99970123 ATGGGCACCTGCACCCCAGAAGG + Exonic
1060549190 9:124477149-124477171 CTGGTGACCCGCAGCCTTGGAGG - Intronic
1061084962 9:128393247-128393269 CGGGTCACCTGCAGCGCCCGTGG + Intergenic
1061615626 9:131776771-131776793 CTGGTCACCAGAAGGCCAGGTGG - Intergenic
1061798131 9:133100375-133100397 CTGGTCACCTGCATCGCGGCGGG + Exonic
1061866107 9:133492518-133492540 TGGGCCACCTGCAGCCCTGGGGG - Intergenic
1062031385 9:134363581-134363603 CTGCTCACCTGCACCCCTTGGGG - Intronic
1062094545 9:134696024-134696046 CTGGACCCTGGCAGCCCAGGAGG - Intronic
1062395400 9:136350683-136350705 CTCGTGACCTTGAGCCCAGGTGG - Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1062737114 9:138143655-138143677 CTGTTCACCTGTGGCCCAGCGGG + Intergenic
1062741967 9:138180224-138180246 CTGGACACCTGTACCCCAGGAGG + Intergenic
1187308459 X:18118584-18118606 CTGGTCACCTCCAGCTTTGGTGG + Intergenic
1189158816 X:38789108-38789130 ATGGTCATCTGCAAACCAGGAGG + Intergenic
1189248473 X:39581469-39581491 AAGCTCACCTGCAGCCAAGGTGG + Intergenic
1190506752 X:51134166-51134188 GTGGTCACCTGCTGCCCTGTGGG - Intergenic
1192592205 X:72369673-72369695 CTGGTCTCCTGCTCCCCAGTAGG + Intronic
1195613474 X:106894763-106894785 CTGGCCTCCTGCAGCCTACGGGG - Intronic
1198263812 X:134991009-134991031 CGGATCAGCAGCAGCCCAGGAGG + Exonic
1198327051 X:135584415-135584437 CTGGACACATGCTGTCCAGGAGG + Intergenic
1198958276 X:142156251-142156273 CTTGCAACCTGCAGACCAGGAGG + Intergenic
1200048065 X:153413056-153413078 CTAGTCACCTGCTGCCCACCTGG - Intergenic