ID: 1018101888

View in Genome Browser
Species Human (GRCh38)
Location 6:160447387-160447409
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 2, 1: 0, 2: 4, 3: 55, 4: 594}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018101888_1018101897 2 Left 1018101888 6:160447387-160447409 CCCTCCAGCACTTCTGTTTCCCT 0: 2
1: 0
2: 4
3: 55
4: 594
Right 1018101897 6:160447412-160447434 GATGCAGGAGAGGAGGCCTTGGG No data
1018101888_1018101898 8 Left 1018101888 6:160447387-160447409 CCCTCCAGCACTTCTGTTTCCCT 0: 2
1: 0
2: 4
3: 55
4: 594
Right 1018101898 6:160447418-160447440 GGAGAGGAGGCCTTGGGTGTTGG 0: 1
1: 1
2: 1
3: 45
4: 537
1018101888_1018101900 20 Left 1018101888 6:160447387-160447409 CCCTCCAGCACTTCTGTTTCCCT 0: 2
1: 0
2: 4
3: 55
4: 594
Right 1018101900 6:160447430-160447452 TTGGGTGTTGGACCCTAAGAAGG No data
1018101888_1018101893 -5 Left 1018101888 6:160447387-160447409 CCCTCCAGCACTTCTGTTTCCCT 0: 2
1: 0
2: 4
3: 55
4: 594
Right 1018101893 6:160447405-160447427 TCCCTGTGATGCAGGAGAGGAGG 0: 1
1: 1
2: 2
3: 27
4: 328
1018101888_1018101892 -8 Left 1018101888 6:160447387-160447409 CCCTCCAGCACTTCTGTTTCCCT 0: 2
1: 0
2: 4
3: 55
4: 594
Right 1018101892 6:160447402-160447424 GTTTCCCTGTGATGCAGGAGAGG 0: 2
1: 0
2: 1
3: 24
4: 256
1018101888_1018101896 1 Left 1018101888 6:160447387-160447409 CCCTCCAGCACTTCTGTTTCCCT 0: 2
1: 0
2: 4
3: 55
4: 594
Right 1018101896 6:160447411-160447433 TGATGCAGGAGAGGAGGCCTTGG 0: 1
1: 1
2: 3
3: 50
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018101888 Original CRISPR AGGGAAACAGAAGTGCTGGA GGG (reversed) Intronic
902191587 1:14766945-14766967 AGGGGAAAATAAGGGCTGGAGGG + Intronic
902802364 1:18838369-18838391 AAGGACAGAGAAGTGTTGGAAGG - Intergenic
903269125 1:22176846-22176868 AGGGACACAGAAGTCCTGCTTGG + Intergenic
903811727 1:26038435-26038457 AGGGCAACAGAAGTGCCAGGGGG + Exonic
903924338 1:26820891-26820913 AGGGAGACCGCAGAGCTGGAAGG + Intergenic
904257885 1:29267998-29268020 AGGGAAATAGAAGTCAAGGATGG + Intronic
904293541 1:29503090-29503112 GGGGAAACACAAGTGCTGTGTGG - Intergenic
904590577 1:31613113-31613135 AGGGACACACAAGTGGGGGAAGG - Intergenic
904913327 1:33951582-33951604 AGGGAACCTGAAGTGGAGGACGG - Intronic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
906126305 1:43428981-43429003 GGGGAAACAGAAGAACTAGAAGG + Intronic
906244952 1:44266982-44267004 AGGGAAGCTGAAGGGATGGAAGG + Intronic
906401209 1:45506108-45506130 AAGGATAAAGAAGTGCTGGTTGG + Intronic
906460501 1:46032415-46032437 AGGGAGACAGCAGGTCTGGATGG - Intronic
906810571 1:48823249-48823271 AGGGAACCAGAGGTGATAGATGG - Intronic
907354770 1:53863139-53863161 AGGGACTCAGAAGAGCGGGACGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907544833 1:55250608-55250630 ATGGAAACGTTAGTGCTGGAGGG - Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907709257 1:56863471-56863493 AGGGAAACAGTACTAATGGATGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908800456 1:67874761-67874783 ATGTCAACAGAAGTGCTGTATGG + Intergenic
909973444 1:82018567-82018589 AGTGACACAGAAGTACTGGCTGG + Intergenic
910486996 1:87725441-87725463 TGGATAACAGAAGAGCTGGAAGG + Intergenic
911286715 1:96003375-96003397 AGGAACACAGAAGTGGGGGAAGG - Intergenic
911872928 1:103121901-103121923 ATGGAAAAAGCAGTGTTGGAGGG + Intergenic
912334943 1:108853565-108853587 AGGGGACCAGAAGGTCTGGAGGG - Intronic
912556867 1:110522868-110522890 AGGGATACAGCACTGCTGGGTGG - Intergenic
913249908 1:116904674-116904696 AGAGAAAGAGAAGTGCAGCAAGG + Intergenic
913705890 1:121422724-121422746 AGGGAAAAAGAAGTGATTCAGGG + Intergenic
914355096 1:146877946-146877968 AGAGAAGCAGAGGGGCTGGAAGG - Intergenic
914957034 1:152172165-152172187 AGGGGACAGGAAGTGCTGGATGG + Intergenic
914998029 1:152561772-152561794 AGGGAAAGAGAAGGGCAGGAGGG - Intronic
915009257 1:152669911-152669933 AGAGAAATAGAAGAGATGGAGGG + Intergenic
916519334 1:165549644-165549666 AAGGAAACAGAGGTGCAAGAAGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917706928 1:177644259-177644281 AGGCAAAAAGAAGTGATGTAGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917910408 1:179638717-179638739 GGGGAAAAAGAAGTGGGGGATGG + Intronic
918422283 1:184376416-184376438 GGAGTAACAGAAGTGCTGGGTGG + Intergenic
918427836 1:184428298-184428320 AGGTAAACAAATGTGCTGCATGG + Intronic
918577004 1:186073537-186073559 AGAGAAACACAGTTGCTGGAGGG + Intronic
918579489 1:186109398-186109420 AGAGAAACTGAAGTACTGGAGGG - Intronic
918815219 1:189172428-189172450 ATGGCAAAAGAAGTGCAGGAGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919105319 1:193142671-193142693 AGGGAAAAGGAAGTGAGGGAAGG - Intronic
919235382 1:194834783-194834805 AGAGAACCAGAAGTGCTGGCTGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920350194 1:205332870-205332892 GGGGAAAGAGAAGTGATGGAGGG + Intergenic
920447304 1:206028373-206028395 AGTGTTTCAGAAGTGCTGGAAGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920755482 1:208726953-208726975 AGGGAAACAGAAGGATTGGTGGG + Intergenic
921890271 1:220346668-220346690 AGAGAAGCAGAAGGGTTGGATGG + Intergenic
922439013 1:225636307-225636329 AGGGAAACAGAACTGCTGACTGG + Intronic
922683998 1:227625291-227625313 AGGAAAACCGAAGTGCTGTTGGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923028464 1:230226222-230226244 AGGGAAAGAAAAGGGCAGGAAGG - Intronic
923338823 1:232991156-232991178 AGGGGGACAGCAGTGCTGTATGG + Intronic
923551957 1:234971135-234971157 GGGGAAACAAAAGTACTGCAGGG - Intergenic
924055470 1:240119994-240120016 AGGCAAACTGAAGTTCTGTAGGG + Intronic
924086680 1:240459311-240459333 AGGAAAACACAATTGCTTGAGGG - Intronic
1062992384 10:1832613-1832635 AGGGACACTGTGGTGCTGGAGGG + Intergenic
1063908260 10:10802802-10802824 AGGGAGACAGAAGTGGAGGTGGG - Intergenic
1064478069 10:15712999-15713021 TGGGAAACAGATCTGCTGTATGG - Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065277319 10:24098172-24098194 ATGGAAACAGAAAAGCTGCAAGG + Intronic
1065357249 10:24854446-24854468 AGCGAAAGAGAAGTGCAGTATGG - Intronic
1065359946 10:24880060-24880082 AAGGAAACTGAAGCGCTGAAAGG - Intronic
1065482985 10:26213359-26213381 AGGGAAAAAGAAGGCCTGGAGGG - Intergenic
1066187637 10:33025687-33025709 GGGGAACCAGAATTGCTGCATGG - Intergenic
1067028321 10:42863117-42863139 TGGTAAGCAGAAGTGCTCGAGGG - Intergenic
1068304274 10:55183829-55183851 AGGCTAACAGAAGTGATGCAAGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069245043 10:66193864-66193886 ACGGGCACAGAAGTGCTGCAAGG + Intronic
1069562270 10:69439291-69439313 TGGGCAAAAGAAGGGCTGGAAGG - Intergenic
1069629871 10:69890981-69891003 AGGGAAACAGAAAGGGAGGAAGG - Intronic
1070362523 10:75704807-75704829 GGGAAAACAGAAGTGCAGAAAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071431885 10:85612940-85612962 AGGGAGAAAGGAGTGCTGGGAGG + Intronic
1071568532 10:86684107-86684129 AGAGAAACAGATGTGGTGCAAGG + Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072795815 10:98353724-98353746 AGGGACACAGAAGCCCTGGAAGG + Intergenic
1073580325 10:104659907-104659929 AGGGAACCAGCAATGTTGGAGGG - Intronic
1074467722 10:113698224-113698246 AGGGAAACTGAGGTGCTGTGAGG + Intronic
1074580378 10:114713254-114713276 AAGGAAGCAGAAGAGCAGGAGGG + Intergenic
1074972912 10:118556041-118556063 AGGGAAGCAGACATGCAGGAAGG - Intergenic
1075091433 10:119446091-119446113 AGGGGTACAGATGGGCTGGAAGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076927738 10:133501652-133501674 AAGCAAACAGAGGTGTTGGAGGG + Intergenic
1078085365 11:8230454-8230476 AGGGAAGCAGAAGGGCTGTGCGG - Exonic
1079090797 11:17478816-17478838 AAGGAAACTGAAGTGCAGAATGG - Intergenic
1079647895 11:22890545-22890567 AGGGAAACAGGAGTTGTTGATGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080721560 11:34854231-34854253 AGTGAAACAGAATGGGTGGAGGG + Intronic
1080913111 11:36625780-36625802 AGGGAATCATGAGTGCTGGCAGG + Intronic
1081732804 11:45383513-45383535 AGGAATACAGAAGTGAAGGAAGG - Intergenic
1082091493 11:48094008-48094030 AGGGAAAAAGAAGGGCTGGGAGG - Intronic
1082206484 11:49441450-49441472 TGTGTAACAGAAGTGCTAGAAGG - Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083583725 11:63841113-63841135 AGGGAAACATAAAGGATGGAAGG - Intronic
1083972053 11:66084271-66084293 AGGGAACAAGAAGTACTGGCAGG + Intronic
1084367716 11:68713715-68713737 AGGGCCCCAGAAATGCTGGATGG - Intronic
1084419232 11:69052084-69052106 AGGGAACCACGAGTGCTGGATGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084953055 11:72677248-72677270 AGGGAAACAGCCGCGCAGGACGG - Intergenic
1085313478 11:75529748-75529770 AGGGCAACAGAAATGACGGAGGG + Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086058305 11:82674398-82674420 CAGGCAACAGAAGTGATGGATGG + Intergenic
1086218018 11:84406876-84406898 AGAGAAAGAGAAGAGGTGGAAGG + Intronic
1086648781 11:89260322-89260344 TGTGTAACAGAAGTGCTAGAAGG + Intronic
1086777263 11:90853979-90854001 GAGCAAACAGAAGGGCTGGATGG - Intergenic
1087430696 11:98050188-98050210 ATGGAAATGGAAGTGGTGGAGGG + Intergenic
1087803929 11:102534996-102535018 AGGGAAACAGATGTGGTCGTGGG + Intergenic
1087842484 11:102934792-102934814 AAGGAAATAGAAGTGTTGGTAGG + Intergenic
1088158489 11:106839351-106839373 AGGGAACAACAGGTGCTGGAGGG + Intronic
1088438088 11:109837674-109837696 AGGGAAACAGGAGGGTTGGGAGG - Intergenic
1088874297 11:113921103-113921125 AAGGAAAAAGATGGGCTGGACGG - Intronic
1089551280 11:119280663-119280685 GGGGACAGAGAGGTGCTGGAGGG - Intronic
1089948481 11:122502740-122502762 AGAGAAAGAGAAGTGTTGCATGG - Intergenic
1090357221 11:126148054-126148076 AGGGAAACTTAATTGCTGGCAGG - Intergenic
1091703361 12:2678374-2678396 AGGGAAAGGGGAGTTCTGGAGGG - Intronic
1092090141 12:5797588-5797610 CTGGAAAGAGAAGTGATGGAAGG - Intronic
1092208399 12:6630863-6630885 CGGGAAGCAGAAGTGTGGGATGG - Intronic
1092331119 12:7588979-7589001 TGGGAAACAGAAATTCTGGGCGG + Intergenic
1092467254 12:8744230-8744252 AGGAAAACAGAAGTGATCCAAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093272777 12:17084658-17084680 AGAGTAACAGAAGTGATAGAAGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095295834 12:40526587-40526609 AGGGAATAGGAAGTCCTGGAAGG - Intronic
1096139744 12:49233304-49233326 AGAGAAACAGAAGTAAAGGAGGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097411779 12:59263417-59263439 ATGGAAACTGAAGAGCTGGATGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098048660 12:66429298-66429320 AGTGAAACCGAGGTGCTGCAAGG - Intronic
1098066238 12:66620360-66620382 AGGGAATCAAAGGTCCTGGATGG - Intronic
1099523370 12:83690535-83690557 AGGGAGACAGAAGTGTAGAATGG + Intergenic
1100166220 12:91921017-91921039 AGAGAAACAGAAGTACAGGGAGG - Intergenic
1101004473 12:100388260-100388282 AGGGAATATGAAGTGTTGGATGG - Intronic
1101276444 12:103206971-103206993 AGGGAAACAGAACTGGTTGGAGG - Intergenic
1102660534 12:114523650-114523672 AGGGAAACAGAAGTGGTTCTGGG + Intergenic
1102930013 12:116855107-116855129 AGGAAAACAGAATTGAGGGATGG - Intergenic
1103108511 12:118253116-118253138 AGGGAAGCAGAAGTAATGGTAGG + Intronic
1104328665 12:127824084-127824106 AGGTAAACAGGACTGATGGAAGG - Intergenic
1106304600 13:28498432-28498454 AGGGACACTGATATGCTGGATGG - Intergenic
1107006860 13:35621467-35621489 AAGGAAACAGAAAAGCAGGATGG - Intronic
1107436274 13:40383210-40383232 AGGGAGACACATGTGCTGGCTGG - Intergenic
1108074630 13:46667017-46667039 AGGGAAAGTGAAGAGCTGGTTGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110559436 13:76894643-76894665 AAGGAAACAGAAGTTTTGCATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112922585 13:104633902-104633924 AGGGTGACAGAATTGCTGGTAGG - Intergenic
1113494360 13:110715256-110715278 AGGGAAACGGAAGAGTTGGGTGG + Exonic
1113726450 13:112606398-112606420 AGGGAAACAGAAGCGCGGAAAGG + Intergenic
1113812829 13:113152965-113152987 AGGGAGACAGCGGGGCTGGATGG + Intergenic
1114162657 14:20186663-20186685 AGAGCAACAGAAGGGCTGAAAGG - Intergenic
1114255743 14:21000034-21000056 AGGAAAACAGAATTGCTGAAGGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115142552 14:30189916-30189938 AGGGAAACAGAAAAGATGGTAGG - Intronic
1115377003 14:32687665-32687687 AAGGAAGTAGAAATGCTGGATGG - Intronic
1116283705 14:42945217-42945239 AGGAAAACAGAATTCCCGGAAGG + Intergenic
1116475833 14:45338188-45338210 AGGGAAACTGAGGTTCTGGTAGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117565524 14:56990638-56990660 AGGGAAGCAGGAGACCTGGAAGG + Intergenic
1117799145 14:59425760-59425782 AGGGAAGCTGCAGGGCTGGAGGG - Intergenic
1117806695 14:59499853-59499875 AGGGAAATAGAGGAGCTAGAGGG - Intronic
1118119701 14:62825840-62825862 AGGGAAACAGGAAGGCAGGAGGG - Intronic
1118397053 14:65346708-65346730 AGAGAAACAGATGTTCTGAATGG - Intergenic
1118527801 14:66665592-66665614 AGGAAACAACAAGTGCTGGAGGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119113081 14:71993918-71993940 AGGGAAAAGGAAGAGTTGGAAGG + Intronic
1119567087 14:75637911-75637933 ATGGGAAGAGAACTGCTGGAGGG + Intronic
1119647021 14:76355340-76355362 AGGGAAACATGAGTGGTGAAAGG - Intronic
1120067243 14:80057049-80057071 AGGGAAAAAGAACTTCTGGAAGG + Intergenic
1121633113 14:95435746-95435768 AGGGAAACAGAAGTGAGCTAGGG + Intronic
1121743401 14:96269378-96269400 AGGGAAAGAGAAGGGCAGGAAGG - Intergenic
1121861055 14:97318613-97318635 AGAGAAACAGAGGTCCTGTAAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123128524 14:105967469-105967491 AGGGAAACAGAACAGATGTACGG + Intergenic
1124149893 15:27167969-27167991 AGGCGAGCAGAAGTGATGGAGGG + Intronic
1124616762 15:31247871-31247893 AGGGAAACCGAGGCTCTGGAGGG - Intergenic
1126103312 15:45132735-45132757 AGGGAAAGAAGAGGGCTGGAAGG - Intronic
1126323689 15:47451480-47451502 AGATAAATATAAGTGCTGGATGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127118420 15:55749855-55749877 AGGAAAAGAGAAGTGATGAAGGG + Intergenic
1127528640 15:59819459-59819481 AACGAAACAGAAGTACTGCAGGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128947325 15:71836360-71836382 CTGGCAAAAGAAGTGCTGGAAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130034467 15:80344506-80344528 AGGGAAACAGAAGTGCCTAGGGG - Intergenic
1130989459 15:88867445-88867467 AGGGAGACACAAGTTCTAGAGGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132243343 15:100276697-100276719 AGGGAAACAGATGGGCTCGCTGG + Intronic
1134014492 16:10878911-10878933 AGGGAAAAAGAACTGCGGGGAGG + Intronic
1134091848 16:11395765-11395787 AGGGAGACAGAGGAGGTGGATGG + Intronic
1134286455 16:12866203-12866225 AGAGAAACCGAAGTGTTGGAAGG - Intergenic
1134829264 16:17310172-17310194 AGGGGAAAAGTAGGGCTGGAGGG - Intronic
1135185393 16:20311145-20311167 TGGAAAGCAGAAGTGCTGAAGGG + Exonic
1135495212 16:22945532-22945554 AGAGAAAGAGAGGTGCTGGCTGG + Intergenic
1135992630 16:27227263-27227285 TGGGAGGCAGAAGTGCTGGGAGG - Intronic
1137359807 16:47803823-47803845 ATGAAAAAAGAAGTGATGGATGG + Intergenic
1137937030 16:52644669-52644691 CTGGTAACAGAAGTGCTGAAGGG + Intergenic
1138059453 16:53874800-53874822 AGGAAGAAAGAGGTGCTGGATGG - Intronic
1138410332 16:56834230-56834252 GAGGAAATAGAAGTACTGGAGGG - Exonic
1138477543 16:57280984-57281006 TGGGAAACAGAAGGGTTTGATGG + Intronic
1138544908 16:57711777-57711799 AGGGAACCAGGAGTGCTGATTGG + Intronic
1139978920 16:70837583-70837605 AGAGAAGCAGAGGGGCTGGAAGG + Intronic
1140705996 16:77630425-77630447 AGGGAAGCTGAAGTACCGGATGG + Intergenic
1141670324 16:85488220-85488242 GGGGAAACTGAAGAGCTGGAAGG - Intergenic
1141717450 16:85734992-85735014 AGTGAAATAGAAGGCCTGGAGGG + Intronic
1142103751 16:88291062-88291084 AGGGAAGCAGAGGTGCCGGACGG - Intergenic
1142253366 16:89002682-89002704 AGGGGGACAGAAGAGCTGGGGGG + Intergenic
1142324305 16:89404321-89404343 AGGAAAATGGAAGTGCAGGAAGG + Intronic
1142541906 17:666311-666333 AGCCAAACAGAAGTGTTTGAAGG + Intronic
1142547411 17:714578-714600 GGGGAAACGGGAGTGCGGGAGGG - Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143043266 17:4055623-4055645 TGAGAAATAGAATTGCTGGAGGG - Intronic
1143190166 17:5034718-5034740 AGGGAAACAGACAGGCTGGCAGG + Exonic
1143353961 17:6310757-6310779 AGAGAATCAGAAGTGGAGGAGGG - Intergenic
1143419343 17:6776585-6776607 ACGGAAACGGAGGTGTTGGAAGG - Intronic
1145816539 17:27798890-27798912 AGGGAAGCAGAGGTGAGGGAAGG + Intronic
1146916344 17:36680646-36680668 GGGGAAACCGAGGTGCTGGCAGG + Intergenic
1147200547 17:38799020-38799042 AGGAAGCCAGAAGGGCTGGAGGG + Intronic
1147819155 17:43231496-43231518 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147819741 17:43234527-43234549 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147821053 17:43241925-43241947 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147821859 17:43246414-43246436 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147825461 17:43267373-43267395 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147826592 17:43273840-43273862 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147827481 17:43278718-43278740 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147828589 17:43284879-43284901 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1147831475 17:43300781-43300803 AGGGAAGCCGAAGGCCTGGAGGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148851405 17:50557261-50557283 AGAGAAACAGAAGTGCTGAGGGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150580411 17:66468765-66468787 AGAGAAACAGAAGTTGTGGCTGG + Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151677399 17:75605728-75605750 TGGGAGACAGAAGGGCTGGACGG + Intergenic
1151934621 17:77254396-77254418 TGGGAAACAGAAAAGCTGAAGGG + Intergenic
1152211791 17:79006302-79006324 AGGGAAGCAGAAGAGCCGGAGGG - Intronic
1153315310 18:3715575-3715597 AGGAAAAGTGAAGTGCTGGGTGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154502364 18:15003211-15003233 AGTGAAACAGGAGTGCTTTATGG + Intergenic
1155035463 18:22021628-22021650 AGGTTAACAGAAGTGTTGGAGGG - Intergenic
1155231678 18:23780370-23780392 AGAGAGACAGAAGTGCTGGAAGG + Intronic
1155363428 18:25026854-25026876 AGGGAAAAATAAAGGCTGGAAGG - Intergenic
1157038419 18:44006610-44006632 AGGGAAACAGAAGAGAGGAAGGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1159078105 18:63704077-63704099 AGGGAAGCAGAACTTATGGAAGG - Intronic
1159359886 18:67386340-67386362 AAGAAAACAGAATTACTGGAAGG - Intergenic
1159424942 18:68272839-68272861 GGAGAAATAAAAGTGCTGGAAGG - Intergenic
1160106845 18:75986505-75986527 AGGGAAAAAGAGGGACTGGAGGG + Intergenic
1162894247 19:13755591-13755613 AGGGAAACAGAGGCTCGGGAAGG + Intronic
1163149554 19:15402907-15402929 GGGGATACAGAAGTGCAGGCAGG - Intronic
1163407111 19:17129622-17129644 GAGGAAACAGAAGTGCTGAAAGG - Intronic
1163676594 19:18658410-18658432 AGGGAAGCAGAAATGGTGGCAGG - Intronic
1164166194 19:22677687-22677709 AGGAAAAAACAGGTGCTGGAGGG + Intergenic
1164587204 19:29483532-29483554 GGGGAAAGAGAAAGGCTGGAGGG + Intergenic
1165698787 19:37921395-37921417 ATGGGAACAGGAGTGCTGGTTGG + Intronic
1165714417 19:38035217-38035239 AGGGAAACAGAAGTTCAGAAAGG - Intronic
1165895800 19:39140177-39140199 AGGGAAGCTGAAATGCAGGAGGG - Intronic
1166621691 19:44306673-44306695 AGGGGAATGGAAGTGCTGGAGGG - Intergenic
1167299057 19:48668831-48668853 AGGGGAACAGGACAGCTGGATGG - Intronic
1167353796 19:48991652-48991674 AGGGGAACACGAGGGCTGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925034658 2:676464-676486 AGTGACACAGGAGTTCTGGAGGG - Intronic
925062382 2:903032-903054 AGTGAAACAGAATCCCTGGAAGG - Intergenic
925245350 2:2377701-2377723 AGGGAAACAGAAGGGGTGGGAGG + Intergenic
925348679 2:3187345-3187367 CTGGAAGCAGAAATGCTGGAGGG + Intergenic
925454068 2:3999127-3999149 AGAGAACCAGAAGATCTGGAAGG - Intergenic
925522491 2:4762307-4762329 AGGTAAACAAAAGTGGTGTATGG - Intergenic
925642580 2:6000453-6000475 GGGGACACAGAGGTGCTGGGTGG - Intergenic
926057501 2:9783094-9783116 AGAGAAAAAGAAGTTCTTGAAGG + Intergenic
926141303 2:10370156-10370178 AGGGAAGGAGAAATGCAGGAAGG - Intronic
928335676 2:30396041-30396063 TGGGATAGAGAAGTTCTGGACGG + Intergenic
928875429 2:36033149-36033171 AGGGAAACAGAAAAAATGGATGG + Intergenic
929057995 2:37895283-37895305 AGGGAAGCAGAAGTGCTAAGAGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930551599 2:52841493-52841515 AGGGAAAAAAAAGTGAGGGATGG - Intergenic
930656347 2:54010702-54010724 AGAGAAACCGAAGTGGAGGAAGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932047553 2:68365025-68365047 AGAGAAAAAGAAGTGATGAAAGG - Intergenic
932138449 2:69253411-69253433 AGAGAAATAGAAGGGCTGAAAGG + Intergenic
932271139 2:70411369-70411391 AGAGCAACAGATGTACTGGAGGG + Intergenic
932842659 2:75098263-75098285 AAGGAAACAGAACTGCAGTATGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933128035 2:78635620-78635642 AGGGAAAGGGAAGTGATGCAAGG - Intergenic
934747198 2:96767173-96767195 TGGGAGACAGAAGTGCTGCAAGG - Intronic
934750788 2:96792871-96792893 AGGGAGACAGGAGTGTTGGGGGG + Intronic
935535209 2:104285639-104285661 AAGGGAAAAGAAGTGGTGGAGGG - Intergenic
935985036 2:108664167-108664189 AGATAAACAGATGTGCTGGTTGG - Intronic
936137476 2:109907822-109907844 AGATAAACAGATGTGCTGGTTGG - Intergenic
936207221 2:110463663-110463685 AGATAAACAGATGTGCTGGTTGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937430685 2:121835723-121835745 AGAGAAACAGAAGGGGAGGAGGG - Intergenic
938000164 2:127727477-127727499 GAAGAAACAGAAGGGCTGGAAGG + Intronic
938501539 2:131833383-131833405 AGTGAAACAGGAGTGCTTTATGG + Intergenic
938786764 2:134636942-134636964 AGTGAGTCAGAAGTGCTGGTTGG - Intronic
938921282 2:135997508-135997530 AGAGAAGCAGAACTGATGGAGGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939352902 2:141063655-141063677 AGGAAAACAGAGATGCAGGATGG - Intronic
940345415 2:152623338-152623360 AGGAAAACAGATGTTCTCGATGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941587001 2:167372456-167372478 GGGGGAATAGAAGTGGTGGAAGG - Intergenic
942172175 2:173299223-173299245 AGGGAACTAGAGGTTCTGGAAGG + Intergenic
942183281 2:173401070-173401092 ATGGGAACAGAACTCCTGGAAGG - Intergenic
942338176 2:174914117-174914139 GAGGAAACAGAAGACCTGGATGG - Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942841136 2:180362216-180362238 AGAGAAACAAAATTACTGGAGGG + Intergenic
944732608 2:202532603-202532625 ATGGCACCAGAAGTGCTAGAAGG + Exonic
944768483 2:202888500-202888522 AGTGGAACAGAAGTACTGGAGGG + Intronic
945197576 2:207251522-207251544 GGGGAAACAGAAATGCTGAGAGG - Intergenic
945406979 2:209460557-209460579 AGGGAAAGAGAAGGGAAGGAAGG - Intronic
945772861 2:214066818-214066840 AGGGAAATAGAAGAGCAGAAAGG + Intronic
946292576 2:218756306-218756328 AGGGAACCAGCATTGCTGAATGG + Intergenic
946327195 2:218990808-218990830 AGGGAGACAGAAGAGCAGGGAGG - Intronic
946365861 2:219248637-219248659 AGTGTAAGAGAAGTCCTGGATGG - Exonic
947441675 2:230127467-230127489 AAGGAAACACAAGTGTTTGAAGG - Intergenic
947641300 2:231709129-231709151 TGGGAATCGGAAGTGCTGGGGGG + Intronic
948029408 2:234804797-234804819 CAGGAAACAGAGGTGCAGGAGGG + Intergenic
948229096 2:236336663-236336685 ATGGAGACAGAAGTGCTTGCTGG - Intronic
948263609 2:236622062-236622084 ACGGAAACAGAAGAGCTGGCTGG + Intergenic
948993594 2:241567012-241567034 AAAGACACAGAAGAGCTGGAAGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172281858 20:33713441-33713463 AGGGCATCAGAAGTGCTGAGGGG - Intronic
1172605015 20:36208217-36208239 AGGGAACCAGAAGTGAAGGATGG - Intronic
1172628586 20:36363248-36363270 AGGGAACCAGAGGTGGTGCAGGG + Intronic
1172684560 20:36744323-36744345 AGAGAAACTGAAGGGCAGGAAGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173360092 20:42335969-42335991 GGGGAAACTGAAGTACTGAAAGG - Intronic
1174224459 20:48985634-48985656 AGGCAAACAGATGATCTGGAAGG - Intronic
1175222213 20:57423760-57423782 AGGAAAACGAAAGTGCAGGAAGG - Intergenic
1175392487 20:58636035-58636057 AGGGAAAAAGAAATGAAGGAAGG + Intergenic
1175808906 20:61846945-61846967 GGGGCACCAGAAGTGCTGTAGGG + Intronic
1175821110 20:61909347-61909369 AGCCAGACACAAGTGCTGGAAGG + Intronic
1176089393 20:63312252-63312274 AGGGCAACAGAACTGCAGGACGG - Intronic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1178561668 21:33643477-33643499 AGGCAAGCAGAAGCGCAGGAAGG - Intronic
1178884132 21:36472111-36472133 AGGGAAACTGAAGTGTAGAAAGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179311850 21:40203139-40203161 TGGGAAACAGATGGGCTGCATGG - Intronic
1179403970 21:41110322-41110344 AGGGAGACACACGTGCTGGGAGG - Intergenic
1180579920 22:16824474-16824496 AGGGAAAAAGAAGGAATGGAGGG + Intergenic
1180990144 22:19930784-19930806 AGTAAAGCAGAAGAGCTGGAGGG + Intronic
1181387899 22:22558344-22558366 AGGGAGACAGAAGGGGGGGAGGG + Intronic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1181664631 22:24384383-24384405 AGGGAAACAAAATTTCAGGAAGG + Intronic
1182239991 22:28908480-28908502 AGGGAAAAAGAAGTCCAAGAGGG + Intronic
1183371002 22:37432386-37432408 AGGGAGACTGAAGTGGGGGAGGG - Intergenic
1184066709 22:42125604-42125626 AGGGAAACAGAAGCCCGGGGTGG + Intergenic
1184069177 22:42137756-42137778 AGGGAAACAGAAGCCCGGGGTGG + Intergenic
1184088506 22:42280262-42280284 AGGGAAATCGAAGTCCAGGATGG + Intronic
1184158480 22:42684328-42684350 AGGGAGACAGAGGTGCTCTATGG + Intergenic
1184237669 22:43193107-43193129 AGGGAATAACAAGTGCTGGCAGG - Intergenic
1184550685 22:45202816-45202838 AGGCAAAGAGAAGGGCTGGGTGG + Intronic
1184942126 22:47776699-47776721 AGGGAAAAAGACGGGTTGGAGGG - Intergenic
949212186 3:1516230-1516252 AGGCAACCAGCAGTCCTGGAGGG + Intergenic
949845763 3:8369000-8369022 AGGGAAACATAATGGCTGGGTGG + Intergenic
949893407 3:8750322-8750344 AGAGAAACAAAAGTGCTGAGAGG + Intronic
950442587 3:13018689-13018711 GGGGATACAGTAGTTCTGGAGGG - Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951370364 3:21838596-21838618 TGGAAAAGAGAAGTTCTGGAAGG + Intronic
952561211 3:34595667-34595689 TGGGAGACAGAAGAGCAGGAAGG + Intergenic
954897848 3:53992184-53992206 AGGTAAGCAGAAGTGTTGCATGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956835785 3:73095093-73095115 AGGGAACTGGTAGTGCTGGAGGG + Intergenic
956869802 3:73405822-73405844 AGGGAAACTGAAGTGCTCTGAGG - Intronic
957451657 3:80388524-80388546 ATGGAAAGAGGAGTGGTGGAAGG - Intergenic
957519107 3:81296044-81296066 ACAGACACAGAAGTGCTGGCAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960574014 3:119211613-119211635 CGGGAGACAGAAGTAGTGGAGGG + Intergenic
960740671 3:120830153-120830175 AGGGAATCAGAAGTGTGGGATGG + Intergenic
960792539 3:121449624-121449646 AGAGAGACAGAAGGGCAGGAGGG + Intronic
960818339 3:121697959-121697981 AAGGAAAGTGAAGTGCTTGAGGG - Exonic
961574597 3:127823996-127824018 GGGGAAAAAAAAATGCTGGAGGG + Intergenic
961824580 3:129592425-129592447 AAGGGAACATAAGTTCTGGAAGG + Intronic
962024179 3:131529604-131529626 AAGGACACATCAGTGCTGGAGGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963414385 3:144976107-144976129 AAGGAAACAGAAGTGCTTGAAGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963659718 3:148109880-148109902 AGGGAATCAAAAGTGCTGAAGGG + Intergenic
964380791 3:156097197-156097219 AGCAAAAGAGAAGTCCTGGAGGG + Intronic
964640131 3:158900386-158900408 AGGAAAACAAAAGAGTTGGAGGG - Intergenic
966398213 3:179522990-179523012 AGGGAAAGAGGAGTGGTGAAAGG + Intergenic
966420744 3:179732072-179732094 AGGGAAACAGACATTCTGAATGG + Intronic
966880490 3:184347142-184347164 AAGGAGACAGGACTGCTGGAGGG + Intronic
967451673 3:189630897-189630919 AGGGAAACTGAAGGGCGGGGAGG + Intergenic
968468104 4:763213-763235 AGCGAAACAGAAAAGATGGATGG + Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969178209 4:5416192-5416214 AGGGAAACAGAAGAGAAGGAAGG - Intronic
969682913 4:8653081-8653103 AGGGAATGAGAAGGGCAGGAGGG - Intergenic
970111242 4:12640184-12640206 AGGTAAACATGAGCGCTGGAGGG - Intergenic
970245102 4:14053011-14053033 AGGGAAGTAGAACTGATGGAAGG - Intergenic
970914975 4:21321961-21321983 AGGGAAAGAGAAATGGTGGAAGG + Intronic
971695115 4:29891374-29891396 AGATAAACAGAAGTTATGGAAGG + Intergenic
971851408 4:31990345-31990367 AGAGAAAGAGAATTGCTGGGTGG - Intergenic
972584901 4:40428851-40428873 AAGGAGACAGAATTGCTGGCCGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
972904323 4:43726627-43726649 AGGGAAGCAGAATTCCTGGCTGG - Intergenic
973079312 4:45970426-45970448 ATGGAAACAGTGGTGCTGGGTGG + Intergenic
974375708 4:61073364-61073386 AGCGAGAGAGAATTGCTGGAGGG - Intergenic
975293888 4:72709623-72709645 AGGCAAAAAGGAGTTCTGGAAGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975907216 4:79227623-79227645 AGGGACACTGAAGAGTTGGACGG - Intronic
976074791 4:81285264-81285286 AGTAAATCAGTAGTGCTGGAGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977582940 4:98744931-98744953 CAGGAATCAGAAGTGCTGGCAGG - Intergenic
978327338 4:107574720-107574742 AGGGACAGGGAAGTGCTGGGAGG + Intergenic
978416765 4:108485174-108485196 ATGGAAACAGAAGTGCAGCCTGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980763762 4:137271057-137271079 CAGGATACAGAAGTTCTGGAGGG - Intergenic
980940347 4:139268152-139268174 TGGGAAAAAGAAGTGTAGGAAGG + Intronic
981672223 4:147300072-147300094 AGGGAGACAGGAGTGCGGAAGGG + Intergenic
981688925 4:147484504-147484526 AGGGAAACAGAGGCCCAGGAGGG - Intronic
982898399 4:160964795-160964817 AGGGATACAGGAATGTTGGATGG + Intergenic
982965862 4:161906619-161906641 GGGGAAACTGAAGTGAGGGAGGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983255365 4:165394120-165394142 GGGGAAACAGAAATAATGGATGG + Intronic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983674327 4:170274597-170274619 AGGGAAACTGAAGTGCTAAAGGG - Intergenic
986159959 5:5218724-5218746 GGGGAATCAGAAGAGCAGGATGG + Intronic
987124924 5:14803191-14803213 AAGGAAACAGATTTGCAGGAGGG - Intronic
987436322 5:17898016-17898038 AGGCAAACAGTCCTGCTGGAGGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988660866 5:33266739-33266761 ACGGAAACAAATGTCCTGGAAGG - Intergenic
988688344 5:33547677-33547699 AGAGAAACAGAAGGGCTTCAGGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988988635 5:36646923-36646945 AGGGAAGCAGAGCTGCTGGCAGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990987677 5:61655768-61655790 GTGGAAGCAGGAGTGCTGGAGGG + Intronic
991562846 5:67972666-67972688 AGGGAAACAGAGGTGGGGGGAGG + Intergenic
991773656 5:70062815-70062837 AGAGAAAGAGAAGTGAAGGAAGG + Intronic
991852950 5:70938239-70938261 AGAGAAAGAGAAGTGAAGGAAGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992342447 5:75839288-75839310 AGGCAAAAAGAATTCCTGGATGG - Intergenic
992387758 5:76302025-76302047 AGGGGAACATATGTGCTAGAAGG + Intronic
992578556 5:78146364-78146386 GAGGAAACTGAAGTGCTTGAAGG - Intronic
992667509 5:79025589-79025611 AAGTAAACAGAAGTTCTGGAGGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993374976 5:87140169-87140191 AGGAAAATAGAAGTGGTGTAGGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994110803 5:96001956-96001978 AGGGAAACAGAAGAATTCGAGGG - Intergenic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995696444 5:114883526-114883548 AGGGAAACAAAAGTGAGGGGGGG + Intergenic
996428984 5:123349555-123349577 ATGGAAACACAAGAGCTGAATGG + Intronic
997109532 5:131059584-131059606 AAGAAAAGAGAAGAGCTGGAAGG - Intergenic
997511211 5:134455862-134455884 AGAGAAAAAGAAGTGGTGGTTGG - Intergenic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
997951133 5:138243421-138243443 AGGGAAAAAGAAGAGGTGGTGGG - Intergenic
998071981 5:139205167-139205189 AGGGAAACAGAGGAGGGGGAGGG - Intronic
998837634 5:146218352-146218374 AGGAAAAGAGAAGTGGTGAAAGG - Intronic
999602244 5:153280166-153280188 AAGGAAACAGAAGATCAGGAAGG - Intergenic
999692756 5:154162923-154162945 AGGGAAGCGGGAGTGCAGGAAGG - Intronic
1000164709 5:158636966-158636988 TGGGGAAAGGAAGTGCTGGATGG - Intergenic
1000268136 5:159657696-159657718 AGGGATAAAGAAGTGCTGGGAGG + Intergenic
1000367859 5:160507577-160507599 AGGGAAGCAGAACTGATGGATGG + Intergenic
1000750664 5:165092284-165092306 GGGGCAACAGAGGTGGTGGAGGG + Intergenic
1002016773 5:176330416-176330438 AGGGAACCAGAATTCCTTGAAGG + Intronic
1002818099 6:697449-697471 GGAGAAACATAAGAGCTGGATGG + Intergenic
1003113110 6:3265351-3265373 AGGGAAAGAGAAGGCCTGGGGGG + Intronic
1004549831 6:16636105-16636127 AGGAAAACAGAAATGATGTAAGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006129007 6:31857557-31857579 TTAGAAACAGAAGTGCTGGGAGG - Intergenic
1006562342 6:34924509-34924531 ACAGAAACAGTAGTGCTGCAGGG - Intronic
1006811070 6:36821020-36821042 GGGGAATAAGAAGTGTTGGAAGG + Intronic
1006906147 6:37535193-37535215 AGGCAAAAAGAAAAGCTGGAGGG + Intergenic
1007283034 6:40726252-40726274 AGGGAATGAGTTGTGCTGGAGGG - Intergenic
1007835565 6:44671469-44671491 GGGGAACCAGAAGTCATGGAGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010296095 6:74198023-74198045 ATGGAGACAGAAGAGCTGAAGGG - Intergenic
1011124182 6:83988450-83988472 AGAGAAACAGAACTACTAGAGGG - Intergenic
1011793457 6:90925948-90925970 AAGGACACAGTAATGCTGGAAGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013075831 6:106770872-106770894 AGGGAAAAATAACAGCTGGAAGG - Intergenic
1013227664 6:108132131-108132153 AGGGGGACAGAGGAGCTGGATGG + Intronic
1013413652 6:109905173-109905195 GAGGAAACTGAAGTTCTGGAGGG + Intergenic
1013458094 6:110350308-110350330 AGAGAAAAAGAAGAGCTGCAGGG - Intronic
1013551402 6:111211127-111211149 AGGGAAACAAGAGTGCAAGAGGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014273568 6:119361899-119361921 AGAGAAACAGGGGTGTTGGAAGG - Intergenic
1014344810 6:120254778-120254800 AGGGAAACAAAAGTGCTGTGTGG + Intergenic
1015506365 6:133992879-133992901 AGGGGAACAGAAAAGCAGGATGG - Intronic
1015738373 6:136425967-136425989 AAGGAAAAAGAAGTGGTAGAAGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016896055 6:149054126-149054148 AGGGAAAGAAAAGTACTTGAGGG + Intronic
1017653097 6:156600999-156601021 ATGGAAACAGAAGTGTTGAGTGG - Intergenic
1017728801 6:157296233-157296255 AGTGAAACGGAGTTGCTGGATGG - Intronic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018179418 6:161207807-161207829 AGGGAAAGAGAAGTCCTAGGAGG + Intronic
1018632360 6:165832242-165832264 TGGGAGACAGAAGTGGTGGTGGG + Intronic
1019184150 6:170211283-170211305 AGGAAAATAAAAGTGCTGGATGG - Intergenic
1019316083 7:387571-387593 AGGGAAACTGAGGCGCAGGAAGG + Intergenic
1019527112 7:1485372-1485394 GGGGACACAGATGTGCTGCAGGG - Exonic
1019958328 7:4435203-4435225 AGGGAAACAGATGTTCTTGGAGG + Intergenic
1020111667 7:5451267-5451289 AGGGACCCAGAGGAGCTGGAGGG - Intronic
1020573067 7:9890535-9890557 AGGGTAACAGAAGAGTGGGAAGG + Intergenic
1021241848 7:18211867-18211889 AGGGCGTCAGAAGTTCTGGAGGG + Intronic
1021858139 7:24878182-24878204 GTGGAAACAGCTGTGCTGGAGGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022028132 7:26467409-26467431 ACAGAAGCAGAGGTGCTGGAAGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022831190 7:34068359-34068381 AGGGGAAGAGAAGGTCTGGAGGG + Intronic
1023085054 7:36562078-36562100 AGGGAAATAGAAATAGTGGAAGG - Intronic
1023439064 7:40168236-40168258 AGGAAAACCCAAGTGCTGTAGGG + Intronic
1024264401 7:47595744-47595766 CGGGGAAGAGAAGTGCTGGGAGG + Intergenic
1024396910 7:48879961-48879983 GGGAAGACAGAAGTTCTGGAAGG - Intergenic
1024951248 7:54862927-54862949 AGGCAGACAGAAGGGCTAGAGGG + Intergenic
1026628554 7:72017953-72017975 AGGTTAACAGAAGTGTTGGCTGG + Intronic
1026764274 7:73150012-73150034 AAGGTAACACAAGTGTTGGATGG - Intergenic
1027040743 7:74959783-74959805 AAGGTAACACAAGTGTTGGATGG - Intergenic
1027082894 7:75242574-75242596 AAGGTAACACAAGTGTTGGATGG + Intergenic
1027464052 7:78492517-78492539 AGGGAAGTAGAAGAGCTGGTTGG - Intronic
1027497067 7:78901103-78901125 ATGAAAACACAAATGCTGGAAGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028425824 7:90687511-90687533 ATGGAAACAGTAGTACTGAAAGG + Intronic
1028473849 7:91232729-91232751 AGTGAAAGAGAAGAGCTGGAAGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032837887 7:135690747-135690769 AGGGAAACAATAGAGCAGGATGG - Intronic
1033002610 7:137523847-137523869 AGGGAAACTGAAGTTCAGAAAGG + Intronic
1033311435 7:140264767-140264789 AGGGAAGCTGAAATGCTGGATGG + Intergenic
1033418156 7:141182583-141182605 AGGGAAACAGAAGAGTTGATAGG + Intronic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034264796 7:149775757-149775779 AGGGAAACAGATGCACTGGAAGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035304025 7:157918412-157918434 AGGGAAGCTGAGGAGCTGGAAGG + Intronic
1035443182 7:158921063-158921085 AGCGAAACACAAGTTCAGGAGGG - Intronic
1035845965 8:2864659-2864681 AAGGAAAAAAATGTGCTGGAGGG + Intergenic
1035954777 8:4064671-4064693 AGGGCAGCAGCAGTGTTGGAGGG - Intronic
1036038627 8:5048475-5048497 ATAGAAACTGATGTGCTGGAGGG + Intergenic
1036070706 8:5438708-5438730 ATGGAAACAGAAGTGGGGAAAGG + Intergenic
1036398842 8:8390460-8390482 AGGGAAACAGAAAGAATGGATGG + Intergenic
1036568661 8:9960356-9960378 ACGGAACCTCAAGTGCTGGATGG + Intergenic
1036694011 8:10963008-10963030 AGGGAACCAGAAATGATCGAAGG - Intronic
1036949153 8:13124379-13124401 TGGGAAGCAGAAGTGTTGGGAGG + Intronic
1037272560 8:17145798-17145820 AAGGAACCAGACGTGCTGAATGG + Intergenic
1037344789 8:17887066-17887088 ATGACAGCAGAAGTGCTGGAGGG + Intronic
1038347841 8:26748351-26748373 AGAAAAACAGCAGGGCTGGACGG - Exonic
1039131803 8:34273364-34273386 AGGGAGACAGAAGACCTGGCTGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040385773 8:46914157-46914179 AGGGAAGCAGAGGTGCTGAGGGG - Intergenic
1041090592 8:54297747-54297769 AGGGAAGCAGCAGAGCTGGTGGG - Intergenic
1041094313 8:54333748-54333770 AGGGAGACAGATGTACTCGAGGG + Intergenic
1042052311 8:64724777-64724799 AGAGAAACAGGAGGGCAGGAGGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042112707 8:65397804-65397826 AGTAAAACAGAAGTACAGGATGG + Intergenic
1042753227 8:72181240-72181262 AGGGAGACATAAGTGCTGAGAGG - Intergenic
1042765606 8:72317991-72318013 AGGGAGACACAAGTGCTGAGAGG - Intergenic
1042985310 8:74576723-74576745 AGGGAAACAGAAGTCAGGTAGGG + Intergenic
1043010910 8:74880391-74880413 AGGCAAACTCAAGTACTGGAGGG - Intergenic
1043388571 8:79769846-79769868 AGGGAAGCAGAGGGGCTGCATGG - Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044360920 8:91282659-91282681 AGGGAAACAGAAGGTCTCGTAGG + Intronic
1044478454 8:92656250-92656272 GGAGAAAAAAAAGTGCTGGAAGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045949024 8:107830546-107830568 AGGGAAACAGAATTGGGAGAAGG - Intergenic
1046789547 8:118306402-118306424 ATGGAATCAGATGTGCTGGATGG + Intronic
1047237601 8:123055873-123055895 AGGCAAACAGAAGTCCTCAATGG - Intronic
1047506626 8:125485708-125485730 AAGGAAACAGAATCCCTGGAGGG - Intergenic
1048421012 8:134278300-134278322 ATGGAAACAGAAGTGCAGGGTGG + Intergenic
1049015071 8:139914315-139914337 AGGGACACCCAGGTGCTGGAAGG + Intronic
1049038136 8:140092627-140092649 GGGGAAAGAGAAGTGCTTGAGGG - Intronic
1049228909 8:141472089-141472111 CAGGAGGCAGAAGTGCTGGAAGG - Intergenic
1049861697 8:144902849-144902871 TGGCACACAGAAGTGCTGGCGGG + Intergenic
1050176159 9:2871443-2871465 AGGGCAATAGAAATCCTGGATGG + Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051425602 9:16928461-16928483 AGGGCAACAGAGGATCTGGAGGG + Intergenic
1052146075 9:25051181-25051203 AGGGAAACAAAAGTGTTCCATGG + Intergenic
1052293328 9:26869544-26869566 AGGGAAACAGAATATCTGGAGGG - Intronic
1052418824 9:28214694-28214716 AAGGAAACAGAAAAGCTGTAAGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055550940 9:77431737-77431759 AGGGAGACAGTGGGGCTGGAAGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056079102 9:83072273-83072295 TTGGAAACAGTATTGCTGGAGGG - Intergenic
1056330139 9:85514347-85514369 AGGGCAGCAGAAGCCCTGGAAGG - Intergenic
1056338483 9:85601245-85601267 AGGGCAGCAGCAGTGCTGGTGGG - Intronic
1056380995 9:86057431-86057453 AGTGAAACAGGAGTGCTTTATGG + Intronic
1056467750 9:86875050-86875072 AGGGAATCAGAGGTCCTTGAAGG + Intergenic
1056518263 9:87375410-87375432 AGGGAAAGATAAGAGCTGCACGG + Intergenic
1056917130 9:90755793-90755815 AGGGAAGGACAAGTGATGGAGGG - Intergenic
1057668323 9:97064406-97064428 TGGAAAATTGAAGTGCTGGAGGG - Intergenic
1059634554 9:116158123-116158145 TGGCAAGCAGAGGTGCTGGATGG - Intronic
1059679154 9:116569500-116569522 AGATAAACAGCAGAGCTGGAAGG - Intronic
1059724680 9:116994996-116995018 AGAAAAACAGAAGTGTAGGAAGG + Intronic
1060079186 9:120625392-120625414 AGGGAGCCAGAAGTGCTGACTGG + Intronic
1061518562 9:131103926-131103948 GGGGAAACCGAGGTGCCGGAAGG - Intronic
1061713456 9:132503476-132503498 GGGGAAACAGAAGCCCTGGGGGG - Intronic
1062498132 9:136841162-136841184 AGTGAAACAGGAGTGCTTTATGG - Exonic
1186205717 X:7197846-7197868 AGGGATACAGTAGTGTTAGAGGG - Intergenic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1186469238 X:9808227-9808249 AAGAAAAAAGAAGTGCAGGAAGG - Intronic
1186701283 X:12092878-12092900 AGGGAATGGGAAGTGCTGGAAGG + Intergenic
1187180242 X:16937067-16937089 AAGGAAAGAGAAGTGATGAAAGG - Intergenic
1187552970 X:20324319-20324341 AGGGGAACCTATGTGCTGGATGG - Intergenic
1187735400 X:22298126-22298148 GGGGAAACTGAGGTGCTGAAAGG - Intergenic
1189008613 X:37021371-37021393 AGGGAAACAGAATTCATGAAAGG + Intergenic
1189591879 X:42521581-42521603 AAAGAAACACAAGTGCTGGCAGG + Intergenic
1189771383 X:44431127-44431149 TAGGAAACAGAAGTTCAGGAAGG + Intergenic
1190338266 X:49276230-49276252 AGGGAAACTGAAGCTCTGAAAGG - Intronic
1190469731 X:50766295-50766317 AGGGAAAAAGTAGTGGTGGCAGG - Intronic
1190559594 X:51673797-51673819 AGGGAAACAGAAGTCCAGGAAGG + Intergenic
1190564697 X:51719524-51719546 AGGGAAACAGAAGTCCAGGAAGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192206576 X:69100572-69100594 AGGGGAATAGAAGGGCTGGCTGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193191313 X:78574065-78574087 GGGGAAACTGAAGTGCAGAAAGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195566443 X:106344910-106344932 AGAGAAACAGACGTGCAAGAGGG - Intergenic
1195879767 X:109580407-109580429 ATGGAAACAGAAATGCAGGAAGG - Intergenic
1195909316 X:109873813-109873835 AGGTAAAAAGAACTACTGGATGG - Intergenic
1196273983 X:113744739-113744761 TGGGAAACAGAAGAGAAGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198253909 X:134908456-134908478 AGGGAAACAGAAGGAGGGGAGGG - Intronic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1199280225 X:145992436-145992458 AGGGAAACATACATGATGGAGGG - Intergenic
1199302202 X:146226246-146226268 CGGGTCACAGAAGTACTGGATGG - Intergenic
1199307318 X:146281080-146281102 AAGAAAAGAGAAGAGCTGGAAGG - Intergenic
1201652293 Y:16302896-16302918 TAGGAAACAGAAGTGATTGATGG + Intergenic
1201725695 Y:17149114-17149136 ATGAAAACAGCAATGCTGGAAGG + Intergenic