ID: 1018107323

View in Genome Browser
Species Human (GRCh38)
Location 6:160501529-160501551
Sequence CTTCTGCTTTATTGCAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018107323_1018107325 10 Left 1018107323 6:160501529-160501551 CCTGCATTGCAATAAAGCAGAAG No data
Right 1018107325 6:160501562-160501584 TTTCTCTCCAGACACCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018107323 Original CRISPR CTTCTGCTTTATTGCAATGC AGG (reversed) Intergenic
No off target data available for this crispr