ID: 1018107527

View in Genome Browser
Species Human (GRCh38)
Location 6:160503223-160503245
Sequence GAGGTGTCCTTGGGAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018107520_1018107527 -7 Left 1018107520 6:160503207-160503229 CCCTGGTAAAAGGCCAGAGGTGT No data
Right 1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG No data
1018107515_1018107527 9 Left 1018107515 6:160503191-160503213 CCCCAGTGCACAGTTACCCTGGT 0: 65
1: 124
2: 136
3: 111
4: 427
Right 1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG No data
1018107516_1018107527 8 Left 1018107516 6:160503192-160503214 CCCAGTGCACAGTTACCCTGGTA 0: 66
1: 117
2: 160
3: 110
4: 202
Right 1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG No data
1018107517_1018107527 7 Left 1018107517 6:160503193-160503215 CCAGTGCACAGTTACCCTGGTAA 0: 66
1: 118
2: 168
3: 114
4: 204
Right 1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG No data
1018107513_1018107527 14 Left 1018107513 6:160503186-160503208 CCTGTCCCCAGTGCACAGTTACC No data
Right 1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG No data
1018107512_1018107527 15 Left 1018107512 6:160503185-160503207 CCCTGTCCCCAGTGCACAGTTAC No data
Right 1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG No data
1018107521_1018107527 -8 Left 1018107521 6:160503208-160503230 CCTGGTAAAAGGCCAGAGGTGTC No data
Right 1018107527 6:160503223-160503245 GAGGTGTCCTTGGGAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018107527 Original CRISPR GAGGTGTCCTTGGGAAGGAT GGG Intergenic
No off target data available for this crispr