ID: 1018116544

View in Genome Browser
Species Human (GRCh38)
Location 6:160591381-160591403
Sequence CATATTTGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 494}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018116544 Original CRISPR CATATTTGGCAGAAGGTGGA AGG (reversed) Intronic
900725257 1:4212380-4212402 CAATCTTGGCAGAAGGTGAAAGG + Intergenic
901945239 1:12696874-12696896 CATCTGTGGTGGAAGGTGGAAGG + Intergenic
903407687 1:23111973-23111995 CAAATTTGGCAGTAGGTGGTAGG - Intronic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
906441036 1:45844934-45844956 CTCACGTGGCAGAAGGTGGAAGG + Intronic
906676758 1:47698781-47698803 GATAGTTGGCAGTGGGTGGAGGG - Intergenic
907508699 1:54942384-54942406 CAATTATGGCAGAAGGTGAAAGG - Intergenic
907771671 1:57471675-57471697 CAATTATGGCAGAAGGTGAAAGG - Intronic
908465931 1:64395199-64395221 CATATATGTAAGAAGATGGATGG - Intergenic
908499472 1:64728903-64728925 CTCACATGGCAGAAGGTGGAAGG - Intergenic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
909224979 1:73007946-73007968 CTCATGTGGCAGAAGGTGGAAGG + Intergenic
909834829 1:80240758-80240780 CAATTATGGCAGAAGGTGAAGGG - Intergenic
911259346 1:95667733-95667755 CTCACTTGGCAGAAGGTAGAAGG + Intergenic
911314268 1:96337453-96337475 CAATTATGGCAGAAGGTGAAGGG + Intergenic
911659835 1:100488976-100488998 CATATAGGGCTGAGGGTGGAAGG + Intronic
912319375 1:108696747-108696769 GATATTTGGAAGAAGCTAGAGGG - Intronic
912547525 1:110461633-110461655 CTCATATGGCAGAAGGTAGAAGG + Intergenic
913144083 1:115972275-115972297 CTCACATGGCAGAAGGTGGAAGG + Intergenic
914850661 1:151311520-151311542 CATTTTGGGTAGAAGGTGGTGGG + Intronic
914900474 1:151708775-151708797 GGAATTTGGCTGAAGGTGGATGG + Intronic
915674620 1:157518660-157518682 TGCATTTGGCAGAAGCTGGAGGG - Intronic
916540495 1:165749104-165749126 CATAATTGCCAGAAGTTGGAAGG - Intronic
916832490 1:168507296-168507318 CATATTGGTCAGTAGTTGGAAGG + Intergenic
917152310 1:171958089-171958111 CAACTGTGGCAGAAGGTGAAAGG + Intronic
918546421 1:185689554-185689576 CCTATGTGGCAGAAGAGGGAGGG - Intergenic
918947401 1:191085308-191085330 TGTATTTGGCAGCAGTTGGATGG - Intergenic
918961138 1:191279689-191279711 CTCACATGGCAGAAGGTGGAAGG + Intergenic
919001040 1:191831769-191831791 CTCAAGTGGCAGAAGGTGGAAGG + Intergenic
919557799 1:199082366-199082388 AATAGTTGGCAGAATGTTGAGGG - Intergenic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
920905972 1:210168682-210168704 CACATCTGGTTGAAGGTGGATGG + Intronic
921011904 1:211150157-211150179 CAAACATGGCAGAAGGTGAAGGG + Intergenic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
922001210 1:221480361-221480383 CAATTATGGCAGAAGGTGAAGGG + Intergenic
922072828 1:222213200-222213222 CAATATTGGCAGAAGGGGGAGGG + Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
923179571 1:231503162-231503184 CAGTCTTGGCAGAAGGTGAAAGG - Intergenic
923676857 1:236087876-236087898 CTCACATGGCAGAAGGTGGAAGG + Intergenic
924145069 1:241065389-241065411 AAAATTTGGCAGAATTTGGAAGG - Intronic
1064360621 10:14661088-14661110 CAGTTGTGGCAGAAGGTGAAGGG - Intronic
1064670013 10:17703706-17703728 CCTATTTGGGAGAGGCTGGAAGG - Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1064934464 10:20664403-20664425 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1065240352 10:23697504-23697526 TAAATTTGGCAGGGGGTGGAGGG - Intronic
1066012185 10:31205081-31205103 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1066400199 10:35068694-35068716 CATATTTGAAACAATGTGGAGGG + Intronic
1067058263 10:43064747-43064769 CACATGGGGCAGAAGGGGGATGG - Intergenic
1067241574 10:44499566-44499588 CACATGTGGAAGAAGGTTGAAGG - Intergenic
1067975850 10:51024699-51024721 CAGTTATGGCAGAAGGTGAAGGG + Intronic
1068158882 10:53237808-53237830 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1068175353 10:53449660-53449682 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1068375256 10:56170045-56170067 CAACCTTGGCAGAAGGTGAAGGG + Intergenic
1069286010 10:66716391-66716413 CTTATTTTGCAGCAGGTGGGTGG - Intronic
1069299051 10:66884009-66884031 CACTTATGGCAGAAGGTGAAGGG + Intronic
1069424379 10:68276964-68276986 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1069969730 10:72156261-72156283 CAATTATGGCAGAAGGTGAAGGG - Intronic
1070389708 10:75958831-75958853 CAATCGTGGCAGAAGGTGGAAGG + Intronic
1071214482 10:83384021-83384043 ATTATTTGGCATAATGTGGATGG - Intergenic
1073983561 10:109182627-109182649 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1075163695 10:120046983-120047005 CAGAATTGGCAGCAGGTGGTAGG + Intergenic
1076155390 10:128201166-128201188 CAAACATGGCAGAAGGTGAAGGG - Intergenic
1078121308 11:8512486-8512508 TAAAATTGGCAGAAGCTGGAAGG + Intronic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078724056 11:13912691-13912713 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1079863951 11:25711695-25711717 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1080251128 11:30234862-30234884 CAGATTTGGGAGAACATGGATGG - Exonic
1080347286 11:31339205-31339227 GAAATTTGGCAGGGGGTGGAGGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1081043098 11:38235899-38235921 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1081245884 11:40765344-40765366 CAATTATGGGAGAAGGTGGAAGG - Intronic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1082097898 11:48146081-48146103 GAGCTTTGGAAGAAGGTGGAAGG - Intronic
1082893997 11:58170762-58170784 CAATTATGGCAGAAGGTGAAAGG - Intronic
1083105503 11:60354431-60354453 CAAACATGGCAGAAAGTGGAAGG - Intronic
1083523855 11:63342433-63342455 CATCCCTGGAAGAAGGTGGAAGG + Intronic
1083704449 11:64504419-64504441 CATATTTGGTTGAAAGAGGAGGG - Intergenic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1085948927 11:81305952-81305974 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1085959233 11:81440170-81440192 CTTACATGGCAGCAGGTGGAAGG + Intergenic
1085987006 11:81799939-81799961 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1087325058 11:96711406-96711428 CAATTGTGGCAGAAGGTGAAAGG - Intergenic
1087369624 11:97266443-97266465 CACTTATGGCAGAAGGTGAAAGG + Intergenic
1087401765 11:97675866-97675888 CTAACATGGCAGAAGGTGGAAGG + Intergenic
1087807411 11:102569787-102569809 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1090368692 11:126230000-126230022 CTTATCTGACAGAAGGTAGAGGG + Intronic
1090805642 11:130200393-130200415 CATCCATGGCAGAAGGTGAAGGG + Intronic
1091324170 11:134671717-134671739 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1091441037 12:511929-511951 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1091441146 12:512380-512402 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1091441229 12:512719-512741 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1091441310 12:513051-513073 CAAAGGTGGAAGAAGGTGGAAGG - Intronic
1092872938 12:12822933-12822955 CAATTATGGCAGAAGGTGAAGGG + Intronic
1093644358 12:21567224-21567246 GATATTTGGCAGCAGGAGAAAGG + Intronic
1094738701 12:33264102-33264124 CCTCTATGGCATAAGGTGGAAGG - Intergenic
1096358655 12:50964826-50964848 CCTATTTGGCAGAAGACAGATGG - Intronic
1097574136 12:61370154-61370176 CTCACATGGCAGAAGGTGGATGG - Intergenic
1098194284 12:67983483-67983505 CACTTATGGCAGAAGGTGAAGGG - Intergenic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1098769490 12:74535780-74535802 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1099700091 12:86073230-86073252 CAATTGTGGCAGAAGGTGAAAGG - Intronic
1100118171 12:91335066-91335088 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1101049122 12:100842732-100842754 CTTACATGGTAGAAGGTGGAAGG + Intronic
1101374897 12:104163117-104163139 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1101688538 12:107050546-107050568 CAATTGTGGCAGAAGGTGAAAGG - Intronic
1101745762 12:107540254-107540276 CTCATATGGCAGGAGGTGGAAGG + Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102645391 12:114400454-114400476 CATGTTCCTCAGAAGGTGGAGGG - Intronic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1105709216 13:22990036-22990058 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1105771774 13:23618924-23618946 CTTACGTGGCAGAAGGTGGAAGG - Intronic
1106017226 13:25881174-25881196 CACACTTGGTAGAATGTGGAAGG + Intronic
1107050605 13:36044173-36044195 CACTCTTGGCAGAAGGTGAAGGG - Intronic
1107719057 13:43229171-43229193 CAATCATGGCAGAAGGTGGAAGG - Intronic
1109381791 13:61571107-61571129 TATCTTTTGAAGAAGGTGGAAGG - Intergenic
1109958537 13:69601816-69601838 CAGTCTTGGCAGAAGGTGAAAGG + Intergenic
1110439812 13:75515512-75515534 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1110910924 13:80962087-80962109 CATATTTGGTAGAACAAGGAAGG - Intergenic
1110924942 13:81138971-81138993 AATATTTCTCAGCAGGTGGAGGG + Intergenic
1111790377 13:92847544-92847566 CAATTATGGCAGAAGGTGAAGGG - Intronic
1112248351 13:97754821-97754843 CCCACCTGGCAGAAGGTGGAGGG + Intergenic
1112263728 13:97902930-97902952 CTCATATGGCAGAAGGTGCAGGG - Intergenic
1112309984 13:98309675-98309697 CATATTTGGCAGAACAAGGAAGG + Intronic
1113165149 13:107432122-107432144 CAAACATGGCAGAAGGTGAAGGG + Intronic
1113971365 13:114193482-114193504 CTCATATGGCAGATGGTGGAAGG + Intergenic
1114411185 14:22502012-22502034 CAGCTTTGTCAGGAGGTGGAAGG + Intergenic
1114752700 14:25223387-25223409 CAATTATGGCAGAAGGTGAATGG + Intergenic
1114773532 14:25455756-25455778 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1114975945 14:28099734-28099756 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1114990700 14:28284805-28284827 AACATATGGCAGAAAGTGGAAGG + Intergenic
1115785708 14:36823568-36823590 CATATTTGGGAAATGGGGGAAGG + Intronic
1115894473 14:38070196-38070218 GATATATGGCAGAGGGTGGAGGG + Intergenic
1116420523 14:44727034-44727056 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1116838546 14:49795429-49795451 GATATTTTGCTAAAGGTGGATGG - Intronic
1116863813 14:50015510-50015532 CAGATGTGGCAGAGGGTGGAGGG - Intergenic
1117514315 14:56485398-56485420 CTTACATGGCAGAAGATGGAAGG + Intergenic
1117946948 14:61037242-61037264 CATTTTTGGCAGAAGGATGGTGG + Intronic
1118024606 14:61756271-61756293 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1118050891 14:62026429-62026451 CTCACATGGCAGAAGGTGGAAGG + Intronic
1119799133 14:77427087-77427109 CATGTGTGGCATAATGTGGAGGG + Exonic
1120146864 14:80988337-80988359 CAATTATGGCAGAAGGTGAAGGG + Intronic
1120370705 14:83630994-83631016 CAAACATGGCAGAAGGTGAAAGG + Intergenic
1120761155 14:88286653-88286675 CAATTATGGCAGAAGGTGAAAGG + Intronic
1121960885 14:98258351-98258373 CTCACTTGGCAGAAGGTGGAGGG + Intergenic
1122442262 14:101740193-101740215 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1123473263 15:20570185-20570207 CACATTTAGCAGATGGTGGTTGG + Intergenic
1123644745 15:22430168-22430190 CACATTTAGCAGATGGTGGTTGG - Intergenic
1123733563 15:23165196-23165218 CACATTTAGCAGATGGTGGTTGG + Intergenic
1123751695 15:23362571-23362593 CACATTTAGCAGATGGTGGTTGG + Intronic
1124284067 15:28386496-28386518 CACATTTAGCAGATGGTGGTTGG + Intronic
1124298630 15:28525118-28525140 CACATTTAGCAGATGGTGGTTGG - Intronic
1124888768 15:33712082-33712104 CAATTGTGGCAGAAGGTGAAGGG + Intronic
1125207393 15:37169534-37169556 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1125274901 15:37979403-37979425 CATTCTTGGCAGAATGTGGTAGG + Intergenic
1126183593 15:45809794-45809816 CAGATGTAGCAGAAGGTAGAAGG + Intergenic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127026821 15:54815779-54815801 CAGTTATGGCAGAAGGTGAAGGG - Intergenic
1127282269 15:57502408-57502430 CAGATATGGGGGAAGGTGGAAGG + Intronic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127647963 15:60976321-60976343 CATATTATGCAGATGGGGGATGG - Intronic
1128320204 15:66688122-66688144 CTTACTTGACAGAAGGTGGAGGG + Intergenic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1131975287 15:97939752-97939774 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1133821474 16:9241004-9241026 CACATATGGCAGAACGTGAAGGG - Intergenic
1134285672 16:12860155-12860177 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1134781851 16:16905382-16905404 TATATGTGGTAGAAGGTGAAGGG - Intergenic
1135199398 16:20423904-20423926 AATTTTTGGCAGACGGTGGGTGG + Exonic
1135219299 16:20599706-20599728 AATTTTTGGCAGATGGTGGTTGG - Intergenic
1135518658 16:23156510-23156532 CACTTATGGCAGAAGGTGAAAGG - Intergenic
1137002343 16:35240293-35240315 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1137549731 16:49429219-49429241 CATATGAGGCAGAAGCTTGAAGG - Intergenic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1138804433 16:60077717-60077739 CATAGTTGGGAGATGGAGGAAGG - Intergenic
1138828302 16:60348151-60348173 CAATTGTGGCAGAAGGTGAAGGG + Intergenic
1139165957 16:64565680-64565702 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1139311886 16:66034439-66034461 CATATTTGAGAGATGGTGGATGG - Intergenic
1139546314 16:67651449-67651471 CAGCTTGGGCAGAAGCTGGAGGG + Exonic
1140348018 16:74233795-74233817 CTCCTATGGCAGAAGGTGGATGG - Intergenic
1140801665 16:78494080-78494102 CAGTTATGGCAGAAGGTGAAGGG + Intronic
1141152608 16:81574506-81574528 GAGATTTGGCAAAAGCTGGAAGG + Intronic
1141224254 16:82100387-82100409 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1141343303 16:83223299-83223321 CTCATATGGCAGAAAGTGGAAGG + Intronic
1141381281 16:83579415-83579437 CAATTATGGCAGAAGGTGAAGGG + Intronic
1142798874 17:2331570-2331592 CAATCATGGCAGAAGGTGGAGGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143273903 17:5695838-5695860 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1143303447 17:5927913-5927935 CATATCTGGTAGCAGGAGGAAGG + Intronic
1145005618 17:19336159-19336181 CAGTTCTGGCAGAAGGTGGCTGG - Exonic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1147841306 17:43373688-43373710 CATACTTCACAGAAGGTGGTGGG - Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1149047128 17:52259197-52259219 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1152029546 17:77833474-77833496 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1152037999 17:77885123-77885145 GACATTTGGCAGAAGGAGGTGGG - Intergenic
1153839588 18:8994364-8994386 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1154504536 18:15022062-15022084 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1155668325 18:28337875-28337897 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1155814519 18:30288543-30288565 CATATTTCTCAGAATATGGAAGG - Intergenic
1156740997 18:40327631-40327653 CATATTAGGCATAAGGGGTATGG + Intergenic
1157068768 18:44381899-44381921 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1157095432 18:44681954-44681976 GATAGTTGGCAGGAGGTGGGGGG - Intronic
1157454286 18:47812304-47812326 CAATTATGGCAGAAGGTGAAGGG - Exonic
1157828733 18:50836755-50836777 GATATTTGGCAAAAGGAAGATGG + Intergenic
1157862229 18:51151801-51151823 CTTATTTGGAAGGAGGTGGTTGG - Intergenic
1158014157 18:52764608-52764630 CATTTGTGGCAGAAGGTGAAGGG - Intronic
1158015477 18:52777864-52777886 TATCTATGGCAGAAGGTAGATGG + Intronic
1158094511 18:53755531-53755553 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1159741710 18:72179487-72179509 TATATTTGACAGAAGGTGGCTGG - Intergenic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1163288995 19:16366239-16366261 CAGATTTGCAAGAATGTGGAGGG + Intronic
1164404366 19:27930171-27930193 CAATTGTGGCAGAAGGTGAAAGG + Intergenic
1164887111 19:31788583-31788605 CATTTCTGGCAGAAGGCAGAGGG - Intergenic
1164916301 19:32054909-32054931 CTCATGTGGCAGAAGGTAGAAGG + Intergenic
1164917182 19:32061168-32061190 CAAAGTTGCCACAAGGTGGATGG - Intergenic
1165205856 19:34185182-34185204 AATATATTGCAGAAGGTGCAAGG + Intronic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1166558711 19:43718339-43718361 CATTTTTGGCACAAGTTAGAGGG - Intronic
1167847134 19:52173795-52173817 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168101360 19:54143172-54143194 GATATTTGGCAGAAGGTACAGGG + Exonic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
925655325 2:6141530-6141552 TACATTTGGCAGGAGGAGGAGGG + Intergenic
925794312 2:7526250-7526272 CAATTATGGCAGAAGGTGAAGGG + Intergenic
925838925 2:7972569-7972591 CAATTATGGCAGAAGGTGAAGGG - Intergenic
927924236 2:26998841-26998863 GATATTTGGCAGAAGATATAAGG - Intronic
928202864 2:29261945-29261967 TATATTTGGTGGATGGTGGAAGG + Intronic
928811342 2:35231064-35231086 CATTCATGGCAGAAGGTGAAGGG - Intergenic
932022773 2:68104613-68104635 CACTTATGGCAGAAGGTGAAAGG + Intronic
932365601 2:71151098-71151120 CTCACTTGGCAGAAGGTGGAAGG + Intergenic
932518990 2:72388048-72388070 CACAACTGGCAGGAGGTGGAAGG + Intronic
933025274 2:77250145-77250167 CATAATTGCCAGAAGTTAGAAGG + Intronic
933394821 2:81717828-81717850 CATATTTGGAAGAAAGCAGATGG + Intergenic
934055129 2:88244945-88244967 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
935277025 2:101483936-101483958 CATAAGGGACAGAAGGTGGAAGG - Intergenic
935324746 2:101925870-101925892 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
935529127 2:104211423-104211445 CAATTATGGCAGAAGGTGAAGGG + Intergenic
935580590 2:104752837-104752859 CAGCTGTGGCAGAAGGTGGCCGG + Intergenic
935938953 2:108218414-108218436 CACTTCTGGCAGAAGGTGAAGGG - Intergenic
938819924 2:134947097-134947119 CATATTTGGCATATAGTGGAAGG + Intronic
939654393 2:144805393-144805415 CATACTGGGCAAAAGGTGGCAGG - Intergenic
940289072 2:152060013-152060035 CAAACATGGCAGAAGGTGAAGGG - Intronic
940298869 2:152158783-152158805 CTTACATGGCAGAAGGTAGAAGG + Intronic
942437077 2:175990370-175990392 CATTCTTGGCAGAAGGTGACAGG - Intronic
942970198 2:181949429-181949451 CATTCATGGCAGAAGGTGAATGG + Intergenic
943456904 2:188119948-188119970 CAATTATGGCAGAAGGTGAAGGG + Intergenic
943972574 2:194429505-194429527 CATTTGTGGCAGAAGGTGAAAGG + Intergenic
944043279 2:195379691-195379713 CAGTTATGGCAGAAGGTGAAGGG - Intergenic
946460903 2:219867912-219867934 CAATTGTGGCAGAAGGTGAAAGG - Intergenic
947047436 2:226004505-226004527 CTCATATGGTAGAAGGTGGAAGG + Intergenic
948326240 2:237123983-237124005 CTCACTTGGCAGATGGTGGAAGG - Intergenic
948402485 2:237693703-237693725 CATAGATGGCAGGAGGAGGATGG + Intronic
948689603 2:239693740-239693762 AATATTAGGGAGAAGATGGAGGG - Intergenic
948710854 2:239824689-239824711 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1169414470 20:5404165-5404187 GATAATTGGCGGAAGTTGGAAGG - Intergenic
1169959560 20:11143898-11143920 CTTATTTGACTGAGGGTGGAAGG + Intergenic
1169991361 20:11506644-11506666 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1171524869 20:25800943-25800965 CTCACATGGCAGAAGGTGGAAGG + Intronic
1171551958 20:26054940-26054962 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1172098398 20:32471858-32471880 CAGACATGGCAGAAGGTGAAGGG - Intronic
1172358950 20:34298994-34299016 CATATAAGGCAGAAGGGGCAGGG - Intronic
1172598358 20:36166208-36166230 CAGATTTGGCATCAGATGGAGGG - Intronic
1177002632 21:15633539-15633561 CAATTTTGGCAGAAGGGTGAAGG + Intergenic
1177302771 21:19271503-19271525 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1177557007 21:22703740-22703762 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1177674872 21:24284150-24284172 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1178279216 21:31266532-31266554 CATATTTGGCTGAGGGAGGCAGG - Exonic
1179823071 21:43948209-43948231 CACCGTTGGTAGAAGGTGGAAGG - Intronic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1181975633 22:26727375-26727397 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1182536878 22:31010427-31010449 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1182634387 22:31712802-31712824 CATATTTGGCAGCTAGTGGATGG - Exonic
1183049203 22:35246937-35246959 CATATGTTCAAGAAGGTGGAGGG - Intergenic
1183285034 22:36956730-36956752 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
1184914069 22:47555555-47555577 CAATCATGGCAGAAGGTGGAGGG + Intergenic
949288541 3:2435465-2435487 AATATTTGGAAAAAGTTGGATGG - Intronic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
951355411 3:21661025-21661047 AATATTTCACAGAATGTGGATGG + Intronic
951782276 3:26377131-26377153 CATATTTGCCTGAAGGTGCTGGG + Intergenic
952246970 3:31605596-31605618 CAATCTTGGCAGAAGGTGAAAGG - Intronic
952419390 3:33117758-33117780 CAGATTTTGGAGAAGGTGGTAGG - Intronic
952494447 3:33903617-33903639 CTGCTGTGGCAGAAGGTGGAAGG + Intergenic
953042117 3:39264795-39264817 CATATTTCCAAGAAGTTGGATGG - Exonic
953678771 3:45024082-45024104 CAATTGTGGCAGAAGGTGAAGGG - Intronic
953772766 3:45791684-45791706 CAATTTTGGAAGAAGGTGAAGGG + Intronic
953804231 3:46054119-46054141 CATATTTGGAAGAAGGGGTCAGG + Intergenic
953886942 3:46719399-46719421 CACATTTGGAAGAAGAGGGAGGG + Intronic
954773126 3:52991768-52991790 CTCATGTGGTAGAAGGTGGAAGG - Intronic
956235696 3:67068754-67068776 CAAAAATGGCAGAAGGTGAAAGG + Intergenic
956758358 3:72412960-72412982 CTCACATGGCAGAAGGTGGAAGG - Intronic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
957789975 3:84928398-84928420 CAATTATGGCAGAAGGTGAAGGG + Intergenic
958745251 3:98126409-98126431 CTTATGTGGTCGAAGGTGGAAGG + Intergenic
958823079 3:98998563-98998585 CAATTATGGCAGAAGGTGAAAGG - Intergenic
958927883 3:100178965-100178987 GAAACTTGGCAGAAGGTGAAGGG + Intergenic
959041263 3:101425034-101425056 CAATTATGGCAGAAGGTGAAAGG - Intronic
959467439 3:106705107-106705129 CAAATTTGGAATATGGTGGAAGG + Intergenic
959716500 3:109439254-109439276 CATACATGGCAGAAGGGGCAAGG - Intergenic
959862407 3:111230614-111230636 CAATTATGGCAGAAGGTGAAGGG - Intronic
960469118 3:118038724-118038746 CTTATTTTGCAGAAGTTGAAGGG - Intergenic
960676440 3:120200006-120200028 CCTATTAGGCAGAAGGCTGAGGG + Intronic
961233894 3:125346718-125346740 CAAATATGGCAGAAGATGAAGGG - Intronic
962229994 3:133655979-133656001 CATATTTGGGATATGCTGGATGG + Intronic
962607446 3:137044529-137044551 TATACTTGGCAGAAGGAGGGTGG - Intergenic
962887785 3:139643434-139643456 CACAGTAGCCAGAAGGTGGAAGG + Intronic
963185079 3:142406490-142406512 CATATTTGGGAGAAAGTAGATGG + Intronic
963687186 3:148451072-148451094 CAATTATGGCAGAAGGTGAAGGG - Intergenic
964812900 3:160684713-160684735 CATGTGTAGCAGGAGGTGGAGGG - Intergenic
965218193 3:165892351-165892373 CATTTATGGCAGAAGGTGAATGG + Intergenic
965348255 3:167579097-167579119 CAATTATGGCAGAAGGTGAAGGG - Intronic
966052156 3:175632342-175632364 CAATCTTGGCAGAAGGTGAAGGG - Intronic
966077160 3:175951268-175951290 CATTTCTGGCAGAGGGTTGAAGG + Intergenic
967101733 3:186221444-186221466 CTGATTTGGCGGAGGGTGGAGGG + Intronic
967513790 3:190342315-190342337 CAATTATGGCAGAAGGTGAAAGG + Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
969041060 4:4296533-4296555 CAATCTTGGCAGAAGGTGAAAGG - Intronic
970119548 4:12737984-12738006 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
970150404 4:13083152-13083174 CATATTCTTCACAAGGTGGACGG + Intergenic
970528203 4:16954560-16954582 CACTTGTGGCAGAAGGTGAAAGG + Intergenic
971272749 4:25166045-25166067 CTCACATGGCAGAAGGTGGAAGG - Intronic
971945671 4:33273530-33273552 CTCACATGGCAGAAGGTGGAAGG - Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974482425 4:62462913-62462935 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
974626075 4:64430227-64430249 CAATTATGGCAGAAGGTGAATGG - Intergenic
975189437 4:71442789-71442811 CATATTTCCTAGAAGGTGCATGG - Intronic
975351323 4:73350614-73350636 CATTCATGGCAGAAGGTGAAGGG + Intergenic
975997406 4:80332217-80332239 TATGTTGGGCAGAAAGTGGAAGG + Intronic
976590478 4:86844818-86844840 CAAACATGGCAGAAGGTGAAGGG + Intronic
977093761 4:92713662-92713684 CAATTATGGCAGAAGGTGAAAGG + Intronic
977772642 4:100878123-100878145 CATTCATGGCAGAAGGTGAAGGG + Intronic
978044107 4:104105813-104105835 CAATTATGGCAGAAGGTGAAGGG - Intergenic
978256104 4:106694454-106694476 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
978417120 4:108488340-108488362 CAATCATGGCAGAAGGTGGAAGG + Intergenic
978511701 4:109527409-109527431 CATGTTTGCCAGAAGGCAGATGG - Exonic
978740862 4:112136378-112136400 CTCATTTGGCAGAAGGAAGAAGG + Intergenic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
980711420 4:136573350-136573372 CAATTATGGCAGAAGGTGAAGGG - Intergenic
981698358 4:147581523-147581545 CTCACATGGCAGAAGGTGGAAGG - Intergenic
983415391 4:167446122-167446144 CACATTTGGGAGAAGATGGTTGG - Intergenic
983500635 4:168495390-168495412 CTCACATGGCAGAAGGTGGAAGG - Intronic
983723707 4:170892605-170892627 CATTTATGGCAGAAAGTGAAAGG + Intergenic
984011947 4:174381961-174381983 CATGTATGGTAGAAGGTGGAGGG + Intergenic
984163986 4:176286189-176286211 CTCATGTGGCAGAAGGTAGAAGG - Intergenic
985219752 4:187691787-187691809 CATAATTGGCAAAAAGTGCAGGG + Intergenic
985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG + Intergenic
986014548 5:3746604-3746626 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
986124299 5:4870700-4870722 CAATTATGGCAGAAGGTGAAGGG - Intergenic
986567662 5:9131236-9131258 CAATTATGGCAGAAGGTGAAAGG + Intronic
987056976 5:14202788-14202810 CAGTTATGGCAGAAGGTGAAAGG - Intronic
987105004 5:14629977-14629999 CAATTATGGCAGAAGGTGAAAGG + Intergenic
987169479 5:15239482-15239504 CAATTATGGCAGAAGGTGAAGGG - Intergenic
987212123 5:15693761-15693783 GAAATTTGGCAGAGGGTGGTTGG + Intronic
987717680 5:21593186-21593208 CAATTATGGTAGAAGGTGGAGGG - Intergenic
987843886 5:23256600-23256622 CATTTTTGGCAGAAGGCAGAAGG - Intergenic
988025363 5:25679745-25679767 CAATTATGGCAGAAGGTGAAAGG - Intergenic
988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG + Intronic
988925246 5:35982998-35983020 CAATTGTGGCAGAAGGTGAAGGG - Intronic
989176537 5:38533053-38533075 CATATTTGGCAAAATGAGGCTGG - Intronic
989233053 5:39109167-39109189 CATAGTTGGCAGCAGTTTGAAGG - Intronic
990716894 5:58647302-58647324 CAATTATGGCAGAAGGTGAAGGG + Intronic
991221526 5:64224900-64224922 CTCACATGGCAGAAGGTGGAAGG - Intronic
991422701 5:66457180-66457202 TGTATTTGGCAGGGGGTGGAGGG + Intergenic
991562834 5:67972611-67972633 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
992375141 5:76181543-76181565 CAATCTTGGCAGAAGGTGAAGGG + Intronic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
993023457 5:82619497-82619519 TTTATATGGCAGATGGTGGAAGG + Intergenic
993215742 5:85020934-85020956 CAATTATGGCAGAAGGTGAAAGG + Intergenic
993315737 5:86403705-86403727 CTTATTTGGTAGGGGGTGGAGGG + Intergenic
993336400 5:86665137-86665159 CATCTTTGGAAGGTGGTGGAAGG + Intergenic
994446988 5:99888555-99888577 CAATTATGGCAGAAGGTGAAGGG - Intergenic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
994967300 5:106690636-106690658 CAATTATGGCAGAAGGTGAAAGG - Intergenic
995533150 5:113110736-113110758 CATCTTTGGCTGCAGGTGGCTGG - Intronic
995726307 5:115184422-115184444 CACTTATGGCAGAAGGTGAAGGG + Intergenic
996182191 5:120432577-120432599 CTCACATGGCAGAAGGTGGAAGG - Intergenic
996184388 5:120458338-120458360 CTTATTTAGCAGACGGGGGAAGG - Intergenic
996434710 5:123422060-123422082 CAGATTTGCAAGAAAGTGGAGGG - Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997864404 5:137448368-137448390 GATGTTTGGTAGAAGGAGGATGG - Intronic
998194810 5:140059297-140059319 CATATTTGGTAGTAGGAAGAAGG - Intergenic
998487552 5:142516331-142516353 CATTCATGGCAGAAGGTGAAGGG - Intergenic
999895446 5:156027941-156027963 CTCATATGGCAGAAGGTGGAAGG + Intronic
999983372 5:156979093-156979115 CAAATTTGGCAGAGGGATGATGG - Intergenic
1000160980 5:158597549-158597571 CACACATGGCAGAAAGTGGAAGG + Intergenic
1000825316 5:166037558-166037580 CAGTTATGGCAGAAGGTGAAAGG + Intergenic
1001202927 5:169735888-169735910 CAAACATGGCAGAAGGTGAAGGG + Intronic
1001864319 5:175090155-175090177 CATCTTGGGCAGGAGATGGAAGG - Intergenic
1001947233 5:175789838-175789860 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1002103163 5:176867315-176867337 CAGATATGGCAGAAGGTGGGGGG + Intronic
1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG + Intergenic
1003008676 6:2405813-2405835 CAATCTTGGCAGAAGGTGAATGG + Intergenic
1003757365 6:9136848-9136870 CACATTTGGCATATGATGGATGG + Intergenic
1003953566 6:11141613-11141635 CATTCATGGCAGAAGGTGAAGGG - Intergenic
1005256126 6:24005205-24005227 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1005671775 6:28113596-28113618 ATTCTATGGCAGAAGGTGGAGGG - Intergenic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1007059285 6:38922377-38922399 CAGATTTGGGAAAAGGTGCATGG + Intronic
1007275391 6:40669565-40669587 CTCACGTGGCAGAAGGTGGAAGG - Intergenic
1007793803 6:44330869-44330891 CAATCATGGCAGAAGGTGGAAGG - Intronic
1008114768 6:47535657-47535679 CATTATTGCCTGAAGGTGGATGG + Intronic
1008755903 6:54795476-54795498 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1008848316 6:55994720-55994742 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1008870851 6:56270841-56270863 CAATTGTGGCAGAAGGTGAAGGG - Intronic
1008916623 6:56794793-56794815 CTGATTTGGCAGAAGATGGCTGG - Intronic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1009535175 6:64873163-64873185 CAATTATGGCAGAAGGTGAAAGG + Intronic
1010676892 6:78755778-78755800 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1010909793 6:81539065-81539087 CAATTGTGGCAGAAGGTGAAGGG - Intronic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1011996319 6:93593421-93593443 CGTCTATAGCAGAAGGTGGAAGG - Intergenic
1012152448 6:95771323-95771345 TATATGAGGCAGAAGGTGGTGGG + Intergenic
1012910190 6:105109371-105109393 CATATTGAGCAGAAAGTGGAGGG + Intronic
1012927173 6:105279393-105279415 CATATTTGGAAGAATGGGGCTGG - Intronic
1013457095 6:110340177-110340199 CACATCTGGCACAAGGAGGATGG + Intronic
1013688307 6:112610754-112610776 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1013832588 6:114292320-114292342 CTCACGTGGCAGAAGGTGGAAGG + Intronic
1014074915 6:117224762-117224784 CTCATATGGCAGATGGTGGAAGG - Intergenic
1014288538 6:119531166-119531188 CAATTTTGGCAGAAGGTGAAGGG - Intergenic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1014778053 6:125533387-125533409 CATCTTTTTCAAAAGGTGGATGG - Intergenic
1015421413 6:133013818-133013840 CTTACGTGGTAGAAGGTGGAAGG - Intergenic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1015680265 6:135799657-135799679 CATTAATGGCAGAAGGTGAAGGG - Intergenic
1015706056 6:136088880-136088902 AAAATTTGGCAGGGGGTGGAGGG + Intronic
1015977028 6:138800969-138800991 CTCACATGGCAGAAGGTGGAAGG + Intronic
1016232648 6:141825181-141825203 GATGTTTGCCAGAGGGTGGAGGG - Intergenic
1016589643 6:145730068-145730090 CAAATATGGCAGAAGATGAAGGG - Intronic
1016691951 6:146948277-146948299 CATATATGGCAGAAGATGAAGGG - Intergenic
1017192374 6:151668237-151668259 CTCATATGGCAGAAGGTAGAAGG + Intronic
1017219555 6:151950123-151950145 CAATCATGGCAGAAGGTGGAAGG - Intronic
1017522557 6:155214517-155214539 GAAATTTGGAAGAAGGTGCATGG - Intronic
1018104363 6:160468741-160468763 TGTGTTTGGCAGAAGGTAGAAGG - Intergenic
1018115416 6:160578991-160579013 AGTATTTGGCAGAAGGTGAAAGG - Intronic
1018116101 6:160586909-160586931 TGTATTTGGCAGAAGGTAGAAGG - Intronic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018116976 6:160595906-160595928 CATATTTCACAGAAGGTGGAAGG - Intronic
1018130777 6:160730742-160730764 TGTATTTGGCAGAAGGTGGGAGG + Intronic
1018133960 6:160760415-160760437 CAATATTGGCAGAAGGTGAAGGG + Intergenic
1018484240 6:164224769-164224791 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1018662786 6:166103817-166103839 CATATTTGTCAGATTATGGAAGG + Intergenic
1020115405 7:5473368-5473390 CAAATGTGGCAGGAGGTGGGAGG - Intronic
1021643920 7:22768850-22768872 CAGTTATGGCAGAAGGTGAAGGG - Intergenic
1022767304 7:33428021-33428043 TTAATTTGGCAGACGGTGGAGGG - Intronic
1023235308 7:38080602-38080624 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1023631839 7:42172817-42172839 GATATTAGGTAGAAGGTGAATGG - Intronic
1024509230 7:50190112-50190134 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1024810886 7:53210895-53210917 CATATTCAGTAGAAGATGGAAGG - Intergenic
1025285530 7:57657543-57657565 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1026527277 7:71165421-71165443 CAAACATGGCAGAAGGTGAAAGG + Intronic
1027624994 7:80533663-80533685 CTCACTTGGCAGAAGGTGGAAGG - Intronic
1027657649 7:80950925-80950947 CATAATTGGCAGGTGGTGTAGGG + Intergenic
1028496122 7:91463265-91463287 CACCTCTGGCAGAGGGTGGAGGG - Intergenic
1029210714 7:98905965-98905987 CATCTTTGACAGCAGGTGGCTGG + Intronic
1030133717 7:106225371-106225393 TTTATTTGGCAGAGGATGGATGG - Intergenic
1031214994 7:118879223-118879245 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1031215001 7:118879265-118879287 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1031243969 7:119283004-119283026 CAAATTTGGCAGAAGAGGGTGGG + Intergenic
1031677014 7:124623066-124623088 CAATTGTGGCAGAAGGTGAAGGG + Intergenic
1032759354 7:134924955-134924977 CAATTATGGCAGAAGGTGAAGGG - Intronic
1033165376 7:139035308-139035330 GATATTTGGCGGGAGGTGGGGGG - Intronic
1033270833 7:139931547-139931569 CAAACATGGCAGAAGGTGAAAGG + Intronic
1033841289 7:145377480-145377502 CAATGATGGCAGAAGGTGGAGGG + Intergenic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1034982896 7:155489933-155489955 CTTCTCTGGCAGCAGGTGGAAGG + Intronic
1035235369 7:157494474-157494496 CACTCTTGGCAGAAGGTGAAGGG + Intergenic
1036165982 8:6434091-6434113 CATAGTTGGCACAAGTGGGAAGG - Intronic
1036476843 8:9101345-9101367 CATTTTTGGCAAAAGGAGAAGGG + Intronic
1036542329 8:9729120-9729142 CTCACTTGGCAGAAGGCGGAAGG + Intronic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037371593 8:18184790-18184812 CACATATGGCAGAAAGTGGAAGG - Intronic
1037383406 8:18312366-18312388 CATGTTTGGCATTAGGTGGCAGG - Intergenic
1037509274 8:19565062-19565084 CAAATTTGGCCGAAGTTTGAAGG + Intronic
1037722993 8:21460359-21460381 GAGATTTGGCAGAAGGGGCAGGG - Intergenic
1038370579 8:26985855-26985877 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1038922927 8:32105353-32105375 CAATCATGGCAGAAGGTGGAAGG + Intronic
1039072689 8:33660770-33660792 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1040401329 8:47052504-47052526 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1041234640 8:55787839-55787861 CAATTATGGCAGAAGGTGAAAGG + Intronic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1042035794 8:64532637-64532659 CGTAGCTGGCAGATGGTGGATGG - Intergenic
1043010766 8:74879300-74879322 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1043138554 8:76558565-76558587 CTCATGTGGCAGAAAGTGGAAGG - Intergenic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1044161396 8:88920758-88920780 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
1044251201 8:90005831-90005853 CACTTGTGGCAGAAGGTGAAGGG + Intronic
1044477198 8:92641514-92641536 CATTTTTGCAACAAGGTGGAAGG - Intergenic
1044636689 8:94332287-94332309 CACTTATGGCAGAAGGTGAAAGG + Intergenic
1044765638 8:95570905-95570927 CACATTTGGCTGAAAGTGAATGG - Intergenic
1044831275 8:96252098-96252120 CAATTATGGCAGAAGGTGAAAGG - Intronic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1045998776 8:108395218-108395240 CTTACATGGCAGAAGGTGAAGGG + Intronic
1046300019 8:112275615-112275637 CAATCATGGCAGAAGGTGGAAGG + Intronic
1046321445 8:112582252-112582274 CAATTGTGGCAGAAGGTGAAGGG - Intronic
1046334702 8:112770326-112770348 CTCATATGGCAGAAGGTGGAAGG - Intronic
1046562087 8:115850734-115850756 TATATTTGGTAGAAGGTAGCTGG + Intergenic
1047329327 8:123872054-123872076 CAAACATGGCAGAAGGTGAAGGG + Intronic
1048117504 8:131541709-131541731 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1048532819 8:135265746-135265768 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1050100935 9:2119033-2119055 TATATTTGGCATAAGGTAAATGG + Intronic
1050176869 9:2877323-2877345 CACTTGTGTCAGAAGGTGGAGGG + Intergenic
1050205568 9:3193011-3193033 CAAATTTGGGAAAAGCTGGATGG - Intergenic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1050481678 9:6094474-6094496 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1052053323 9:23874538-23874560 CATATCAGGCAGAATGTGAATGG - Intergenic
1052179126 9:25502905-25502927 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1055337600 9:75248278-75248300 CAACTGTGGCAGAAGGTGAAGGG - Intergenic
1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1058293897 9:103280498-103280520 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1059723945 9:116987502-116987524 CAGTTATGGCAGAAGGTGAAGGG - Intronic
1060011600 9:120048329-120048351 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1060569241 9:124623047-124623069 CTTATTTGGCACACTGTGGAGGG - Intronic
1185977571 X:4738633-4738655 CCTCTTTGGGAGCAGGTGGAAGG + Intergenic
1187132381 X:16515370-16515392 CAGTTATGGCAGAAGGTGAAAGG + Intergenic
1188365758 X:29312930-29312952 CAATTATGGCAGAAGGTGAAAGG - Intronic
1188674094 X:32917214-32917236 CAATCTTGGCAGAAGGTGAAGGG - Intronic
1189410494 X:40766154-40766176 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
1189666342 X:43358885-43358907 CTTATGTGGCAGAAGGTAGAAGG + Intergenic
1190566716 X:51737946-51737968 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1190997128 X:55620725-55620747 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1192670748 X:73138219-73138241 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1192733652 X:73827112-73827134 CAAGTAGGGCAGAAGGTGGAAGG - Intergenic
1193322671 X:80141459-80141481 TATATTTGGAAGATGGAGGAAGG - Intergenic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1194172947 X:90611236-90611258 CATTCATGGCAGAAGGTGAAGGG + Intergenic
1194737350 X:97528465-97528487 CATTTATGGCAGAAGGAGAAGGG + Intronic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1195740748 X:108062467-108062489 CAGATTTAGCAGAAAGTGAATGG - Intronic
1196583658 X:117404793-117404815 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1198261944 X:134972897-134972919 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1198378644 X:136063724-136063746 TATATTTGTCTGTAGGTGGAAGG + Intergenic
1198435001 X:136608697-136608719 CATATCAGGCAGCAGGTGGCAGG + Intergenic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1199203076 X:145116189-145116211 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1199440050 X:147857651-147857673 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1199584121 X:149395208-149395230 ACTATATGGCAGAAGGTGAAGGG - Intergenic
1200132114 X:153855921-153855943 GGTGCTTGGCAGAAGGTGGATGG - Intergenic
1200660873 Y:5955957-5955979 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1201927915 Y:19310344-19310366 CAATTATGGCAGAAGGTGAAAGG + Intergenic