ID: 1018122925

View in Genome Browser
Species Human (GRCh38)
Location 6:160655206-160655228
Sequence ATTGGTCTGTTATTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 1, 2: 26, 3: 215, 4: 333}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018122925_1018122931 21 Left 1018122925 6:160655206-160655228 CCAAAGCCCAATAACAGACCAAT 0: 1
1: 1
2: 26
3: 215
4: 333
Right 1018122931 6:160655250-160655272 TAGTTATCTGCAGAAGTGGCAGG 0: 1
1: 0
2: 3
3: 20
4: 138
1018122925_1018122928 -6 Left 1018122925 6:160655206-160655228 CCAAAGCCCAATAACAGACCAAT 0: 1
1: 1
2: 26
3: 215
4: 333
Right 1018122928 6:160655223-160655245 ACCAATAGCTGTCTCTCAAAAGG 0: 1
1: 14
2: 214
3: 221
4: 310
1018122925_1018122930 17 Left 1018122925 6:160655206-160655228 CCAAAGCCCAATAACAGACCAAT 0: 1
1: 1
2: 26
3: 215
4: 333
Right 1018122930 6:160655246-160655268 AGAGTAGTTATCTGCAGAAGTGG 0: 1
1: 5
2: 5
3: 16
4: 216
1018122925_1018122932 22 Left 1018122925 6:160655206-160655228 CCAAAGCCCAATAACAGACCAAT 0: 1
1: 1
2: 26
3: 215
4: 333
Right 1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018122925 Original CRISPR ATTGGTCTGTTATTGGGCTT TGG (reversed) Intronic
900434963 1:2625619-2625641 CTTGGCCCGTTACTGGGCTTTGG + Intronic
901904046 1:12392641-12392663 CTTGGCCTGTTACTGGGCTTTGG - Intronic
904179489 1:28655928-28655950 CTTGGCCTATTACTGGGCTTTGG - Intergenic
904305787 1:29588432-29588454 ATTGTTCTGCTATTGGTATTTGG - Intergenic
904335937 1:29798029-29798051 CTTGGCCTATTACTGGGCTTTGG + Intergenic
904452840 1:30627347-30627369 ATTGGTCTGTTACTGAGCAGTGG - Intergenic
905354070 1:37368826-37368848 CTTGGCCTGTTACTTGGCTTTGG + Intergenic
905465229 1:38148142-38148164 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
905583474 1:39099691-39099713 ATTGAACTGTTATGGGGGTTGGG - Intronic
905690442 1:39938830-39938852 ATTGGTCTGTTTTTGGAGATGGG + Intergenic
906050493 1:42867457-42867479 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
906879679 1:49576506-49576528 TTTGGCTTGTTACTGGGCTTTGG + Intronic
907780346 1:57560877-57560899 CTTGGCCTGTTACTGGGCTTTGG + Intronic
909576925 1:77185901-77185923 CTTGGCCTGTTACTGGGCTTTGG + Intronic
909810958 1:79931380-79931402 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910370639 1:86512171-86512193 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910630226 1:89346295-89346317 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910638987 1:89439931-89439953 CTTGGCCTGTTACTGGACTTTGG - Intergenic
910790326 1:91043763-91043785 GTTGGCCTGTTACTGGGCTTTGG + Intergenic
910831093 1:91463381-91463403 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
910948218 1:92616731-92616753 GTTGGCCTGTTACTGGACTTTGG + Intronic
911109093 1:94164162-94164184 CTTGGCCTGTTACTGGGCTTTGG - Intronic
911203534 1:95070275-95070297 AATGGTCTGTTTTTATGCTTAGG - Intronic
911257320 1:95647321-95647343 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
911738393 1:101361876-101361898 CTTGGCCTGTTACTGGGCTTCGG - Intergenic
911798713 1:102107527-102107549 ATTGGTCTGTTATTGTGCAGTGG - Intergenic
911980430 1:104559464-104559486 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
911981895 1:104579219-104579241 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
912252024 1:108021345-108021367 CTTGGGTTGTTACTGGGCTTTGG - Intergenic
912671943 1:111637023-111637045 ATGGGTCTGTGATAGGGCTAGGG + Intronic
912733318 1:112128786-112128808 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
912943808 1:114068161-114068183 TTTAGCCTGTTACTGGGCTTTGG - Intergenic
916106325 1:161435284-161435306 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
916285321 1:163099571-163099593 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
916640762 1:166726277-166726299 ATTGGTATGTTATTGTGCAATGG + Intergenic
917217209 1:172690870-172690892 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
917462712 1:175246226-175246248 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
917891700 1:179445058-179445080 ACTGGGCAGATATTGGGCTTGGG + Exonic
918268414 1:182869966-182869988 ATTGGTCTGTAAGTGCACTTGGG - Intronic
918774497 1:188610790-188610812 CTTTGCCTGTTACTGGGCTTTGG + Intergenic
918815083 1:189171271-189171293 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
918918226 1:190671836-190671858 CTTGGCCTGTTAATGGGGTTTGG - Intergenic
918958249 1:191237992-191238014 CTTGGCCTGTTACTGGCCTTTGG + Intergenic
919241777 1:194924247-194924269 ATTGGCCTGTTAATGGGCATTGG + Intergenic
920197436 1:204238409-204238431 GTTGGTCTGTTACTGGGCTTTGG + Intronic
922344819 1:224687713-224687735 ATTGGTCTGTTACTGTGCAAGGG - Intronic
922781046 1:228252538-228252560 CTTGGCCTGTTACTGAGCTTTGG - Intronic
922888908 1:229045541-229045563 ATTGATCTGTTGATGGACTTGGG - Intergenic
923253565 1:232199394-232199416 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
923813615 1:237348275-237348297 ATTTTTCTGTTATTAGCCTTTGG + Intronic
924378034 1:243433647-243433669 AAAGGTCTGTTATTGAGATTTGG + Intronic
924670536 1:246120004-246120026 ATTGGTCTATTTTTATGCTTAGG + Intronic
924840772 1:247707789-247707811 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1063407199 10:5807952-5807974 ATTGCTCTGTAATCGGGGTTGGG - Intronic
1064545684 10:16448092-16448114 CTTGGCCAGTTACTGGGCTTTGG - Intronic
1065005330 10:21374207-21374229 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1065641959 10:27792177-27792199 GTTGGTCTGTGATGGGGCGTAGG - Intergenic
1066156045 10:32679195-32679217 ATTGGCCTTTTATTGGGCTTTGG - Intronic
1066160318 10:32721236-32721258 TTTGGCCTGTTATTGGACATTGG - Intronic
1066167023 10:32799187-32799209 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1067333141 10:45340260-45340282 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1067754346 10:48993676-48993698 CTTGGTTTGTTACTGAGCTTTGG - Intergenic
1068007669 10:51409527-51409549 CTTGGCCTGTCACTGGGCTTTGG - Intronic
1068447214 10:57138636-57138658 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1068837212 10:61568335-61568357 CTTGGCCTGTTACTGGGCTGTGG - Intergenic
1069192299 10:65506327-65506349 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1069300712 10:66903721-66903743 GTTGGTCTGTTATTGGTGTATGG - Intronic
1069790825 10:71019540-71019562 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1070166263 10:73900308-73900330 ATTTGTCTGTGCTTGGGCTGTGG - Intergenic
1070446963 10:76514560-76514582 TTTGGTTTTTTATTGTGCTTAGG + Intronic
1070974558 10:80595961-80595983 ATTGGTGTGTCCTTGGGCTGGGG + Intronic
1071131591 10:82399802-82399824 ATTTGTCTGTGATTCTGCTTTGG - Intronic
1071267080 10:83973959-83973981 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1071673923 10:87637386-87637408 TTTGGCCTGTTACTGGGCCTTGG - Intergenic
1071937692 10:90549319-90549341 CTTGGCCTGTTCCTGGGCTTTGG + Intergenic
1071942778 10:90607735-90607757 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1072360472 10:94654186-94654208 CTTGGACTGTTACTCGGCTTTGG + Intergenic
1073557353 10:104465943-104465965 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
1073656677 10:105424441-105424463 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1073918472 10:108432272-108432294 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1073957678 10:108891610-108891632 CTTGGCCTGTTACTGGGCCTCGG - Intergenic
1074926234 10:118075184-118075206 ATTGGTCTTTTAGTGAGCCTGGG + Intergenic
1075606793 10:123817442-123817464 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1076772625 10:132674796-132674818 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1076927412 10:133499183-133499205 CTTAGCCTGTTACTGGGCTTTGG - Intergenic
1077649336 11:3955734-3955756 ATTGGTCTGGTGTGGGGCCTGGG + Intronic
1079008251 11:16807862-16807884 ATTGGTCTGGGATGGGGCCTGGG + Intronic
1079525708 11:21385126-21385148 ATTGCTGTGTTATTGTTCTTCGG + Intronic
1080076597 11:28157538-28157560 CTTGGCCTGTTACTGGGCATTGG + Intronic
1081065457 11:38534859-38534881 CTTGGCTTGTTATTGGGCTTCGG - Intergenic
1081072780 11:38631138-38631160 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1081942161 11:46952843-46952865 ATTGGTTTGTTGCTGGGCGTTGG + Intronic
1083141201 11:60723167-60723189 ATTGCTCTGTTTTGGGGCATTGG + Intergenic
1085097383 11:73772426-73772448 GTTGGTCATTTCTTGGGCTTTGG - Intergenic
1085747574 11:79128257-79128279 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1085954691 11:81377576-81377598 CTATGTCTGGTATTGGGCTTTGG - Intergenic
1086834119 11:91600410-91600432 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1088097208 11:106115175-106115197 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1088191657 11:107234473-107234495 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1088836659 11:113583406-113583428 CTTGGCCTGTCACTGGGCTTTGG + Intergenic
1089871746 11:121680587-121680609 ATTTATCTGTTTTTGGTCTTTGG + Intergenic
1089903609 11:122013626-122013648 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1090209489 11:124908033-124908055 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1091051741 11:132378773-132378795 TTTGGCCTGTTACTGAGCTTTGG + Intergenic
1091454534 12:597053-597075 ATAGGTGTGTTATTTGGTTTAGG - Intronic
1092381563 12:8000956-8000978 CCTGGTCTGTTACTGAGCTTTGG + Intergenic
1092501746 12:9054105-9054127 ACTGGTCTGTTATTGTGCACTGG + Intergenic
1093031867 12:14295932-14295954 GTTGGCCTGTTACTGGGCTTTGG - Intergenic
1093036340 12:14335701-14335723 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1093645732 12:21583688-21583710 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1094102534 12:26779280-26779302 CTTGGTCTGGTACTGGGCTTTGG + Intronic
1095603857 12:44044352-44044374 CTTGGCCTGTTTCTGGGCTTTGG + Intronic
1095844392 12:46729950-46729972 CTTGGCCTGTTAATGGGCTAAGG - Intergenic
1095856237 12:46863657-46863679 CTTGGCCTGTTACTGGGCTTAGG - Intergenic
1096288715 12:50322978-50323000 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1096457463 12:51799419-51799441 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1096595787 12:52694626-52694648 CTTGGTCTGGTACAGGGCTTCGG + Exonic
1097437835 12:59572236-59572258 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1097821338 12:64131846-64131868 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1097843354 12:64342743-64342765 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1098673044 12:73254262-73254284 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1098716093 12:73829833-73829855 CTTGGCCCGTTACTGGGCTTTGG + Intergenic
1098731054 12:74037366-74037388 GTTGGCCTGTTACTGGGCTTTGG + Intergenic
1099127507 12:78781882-78781904 TTGGATCTGTTTTTGGGCTTTGG - Intergenic
1099365927 12:81765402-81765424 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1099375650 12:81893975-81893997 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1099379379 12:81936522-81936544 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1099508564 12:83507205-83507227 CTTGGCCTGCTACTGGGCTTCGG + Intergenic
1099689783 12:85938055-85938077 CTTTGTCTGTTACTGGGCTTTGG + Intergenic
1099735785 12:86565057-86565079 CTTGGCCTGTTACTGCGCTTTGG + Intronic
1100083306 12:90878230-90878252 CTTTGCCTGTTACTGGGCTTTGG + Intergenic
1100231951 12:92617872-92617894 TTTGGCCTGTTATTAGGCCTCGG + Intergenic
1100241149 12:92711590-92711612 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1101534665 12:105606086-105606108 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1101543074 12:105682654-105682676 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1102686987 12:114732517-114732539 ATTGGCCTGTTGCTGTGCTTTGG - Intergenic
1102692020 12:114768850-114768872 ATTTGTCTGTTGTTTTGCTTTGG - Intergenic
1102757253 12:115352319-115352341 GTTGCTCTGTTAGTGGGCATAGG + Intergenic
1103844195 12:123890090-123890112 ATTGGCCGGTTCCTGGGCTTAGG + Intronic
1105037117 12:132933619-132933641 ATTGATCTGTTTCTGGGTTTTGG - Intronic
1105655530 13:22433347-22433369 ATTGGTCTTTTATTGGATTTTGG + Intergenic
1105740112 13:23315194-23315216 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1106055479 13:26232866-26232888 ATTGGTCAGGTATGGGGCCTGGG + Intergenic
1106976229 13:35219769-35219791 ACTGGTCTCTTCTTGGCCTTTGG - Intronic
1107587268 13:41864427-41864449 ATTGGTCTGTTGATGGACCTTGG - Intronic
1107804103 13:44138234-44138256 ATAGGTCTGTGATGGGGCATGGG - Intergenic
1107983573 13:45755954-45755976 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1108302431 13:49091967-49091989 CTTGGCCCGTTACTGGGCTTTGG - Intronic
1108904279 13:55449989-55450011 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1109293227 13:60500136-60500158 CTTGGCCTGTTACTGGGTTTTGG + Intronic
1109519025 13:63484819-63484841 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1109583051 13:64366185-64366207 CTTGGCCTGTTACTGGGCTTCGG + Intergenic
1109951021 13:69502187-69502209 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1110227828 13:73138394-73138416 ATTAATCTGTTATTGAACTTTGG + Intergenic
1110834132 13:80064611-80064633 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1111246295 13:85546417-85546439 ATTTATCTCTTATTGGACTTTGG - Intergenic
1111317505 13:86581819-86581841 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1112231125 13:97590146-97590168 CTTGGTTTGTTACTGGTCTTTGG - Intergenic
1112776429 13:102848599-102848621 ATTGAAATGTTATTGGTCTTTGG + Intronic
1114205873 14:20570787-20570809 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1114905374 14:27120404-27120426 ATTGGCCTGTTACTTGTCTTTGG - Intergenic
1115130696 14:30049278-30049300 CTTGGCCTGTCACTGGGCTTTGG + Intronic
1115143402 14:30199405-30199427 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1115678810 14:35713043-35713065 AGTGGTCTTTTATTGCTCTTGGG - Intronic
1116058911 14:39896956-39896978 CTTGGCCTGTTGCTGGGCTTTGG + Intergenic
1116068097 14:40009189-40009211 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1116158375 14:41236647-41236669 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1116531453 14:45978207-45978229 CTTGGACTGTTACTAGGCTTTGG - Intergenic
1117028720 14:51648443-51648465 ATTGGTCTGTGGTATGGCTTGGG - Intronic
1117596272 14:57329865-57329887 TTTGGCCTGTTATTGAGCTTTGG - Intergenic
1117634136 14:57724391-57724413 GTTGGCCTGTTACTGGGTTTTGG + Intronic
1118095474 14:62532502-62532524 ATAGGCCTGTTCTGGGGCTTTGG - Intergenic
1118122431 14:62860152-62860174 CTTAGCCTGTTACTGGGCTTTGG - Intronic
1118263758 14:64273449-64273471 ATATGTCTGTTATTGGGCTGAGG + Intronic
1118880771 14:69824000-69824022 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1119107561 14:71938821-71938843 CTTGGCCTATTACTGGGCTTTGG - Intronic
1120444617 14:84578962-84578984 ATTGGTCCGTGGGTGGGCTTTGG - Intergenic
1120555989 14:85930420-85930442 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1121124266 14:91395829-91395851 ATTGGTTTGGGATTGGGTTTCGG - Intronic
1126283613 15:46986295-46986317 CTTGGCCTGTTATTGGGCTCTGG + Intergenic
1127356919 15:58209207-58209229 CTTGGCCTGTTATTGGGCTTTGG + Intronic
1129492182 15:75938064-75938086 TTTGGCCTGCTTTTGGGCTTAGG - Exonic
1129796840 15:78384154-78384176 ATTGGACTGTTGTTGGCTTTAGG + Intergenic
1131533428 15:93214002-93214024 AATGGTCTGGAATTGGCCTTTGG + Intergenic
1131724013 15:95202813-95202835 CTTGGCCTGTTACCGGGCTTTGG + Intergenic
1132984104 16:2754900-2754922 TTGGGTCTGCTACTGGGCTTGGG + Intronic
1133675393 16:8066083-8066105 ATTGGTCTGTTACTGTGCAATGG + Intergenic
1137331121 16:47497579-47497601 ATTGTTCTGTCATTGGGATTTGG + Intronic
1138868387 16:60850800-60850822 CTTTTCCTGTTATTGGGCTTTGG + Intergenic
1140520277 16:75575064-75575086 ATTGGTCTGGGGTAGGGCTTGGG + Intronic
1141559540 16:84858020-84858042 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1141837172 16:86549405-86549427 ATGGGTCTTTTATTGGTCTTGGG - Intronic
1143306848 17:5954157-5954179 ACTGGTCTATTATTGAGCTTGGG - Intronic
1146237986 17:31185966-31185988 CTTGACCTGTTACTGGGCTTTGG + Intronic
1146836358 17:36114018-36114040 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1146850936 17:36221058-36221080 CTTAGCCTGTTACTGGGCTTTGG + Intronic
1148340744 17:46872161-46872183 ATTGGTTTGGAATTGGGCCTGGG - Intronic
1148714518 17:49706536-49706558 TGTGGTCTTTTGTTGGGCTTAGG - Intronic
1149650799 17:58275287-58275309 GTGGGTCTGTTATTGGTGTTGGG - Intronic
1150113464 17:62522969-62522991 AATAGTCTGTTCTTGGGCTAAGG + Intronic
1151247893 17:72809343-72809365 ATTGTTCTGTTATTTGGTGTGGG + Intronic
1153089712 18:1330176-1330198 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1154252669 18:12757261-12757283 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
1154506175 18:15042904-15042926 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1155411330 18:25548506-25548528 ATTTGTCTGTTGATGGACTTAGG - Intergenic
1155940710 18:31799612-31799634 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
1156303863 18:35858708-35858730 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1156606374 18:38671779-38671801 CTTGGCCTGTGATTGGGCTTTGG + Intergenic
1156879689 18:42062010-42062032 ATTGGTCTGAGATTGGGCTCAGG + Intronic
1157327325 18:46678590-46678612 TTTGGTCTGTGGTTGGACTTAGG - Intronic
1157341205 18:46780041-46780063 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1157870929 18:51229567-51229589 CTTGGTCTGCTACTGGGCCTTGG - Intergenic
1157998503 18:52588110-52588132 CTTGGCCTGTTACTGGACTTTGG - Intronic
1158241679 18:55385340-55385362 ATTGGCCTCTTATTTGGCATAGG - Intronic
1159105279 18:63997188-63997210 ATTGTCCTGTTATTGGGCCTAGG + Intronic
1159287791 18:66375496-66375518 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1159559102 18:69975337-69975359 CTTGGCTTGTTACTGGGCTTTGG - Intergenic
1160092466 18:75840029-75840051 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
1160285745 18:77541369-77541391 ACCGGGCTGTTAATGGGCTTTGG - Intergenic
1160299063 18:77662900-77662922 ATTGGTCTGTAACTGGGCAGTGG + Intergenic
1163363493 19:16862799-16862821 ATTCATCTGTTATTTGACTTAGG + Intronic
1164097083 19:22021329-22021351 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1164117255 19:22234560-22234582 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1165171006 19:33891627-33891649 ATTGGTGTCTTAGTTGGCTTGGG - Intergenic
925279955 2:2676882-2676904 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
925460729 2:4060460-4060482 CTTTGTCTATTACTGGGCTTTGG + Intergenic
926810393 2:16750662-16750684 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
926826765 2:16913682-16913704 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
927008720 2:18879738-18879760 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
927312580 2:21647895-21647917 AGTGTTCTGTTACTAGGCTTTGG + Intergenic
927660434 2:24988683-24988705 CTTGGCCTGTTACTGGTCTTTGG + Intergenic
928241844 2:29593203-29593225 ATTGGTCTGTGAAGGGGCCTTGG + Intronic
929269823 2:39960767-39960789 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
930018358 2:46986172-46986194 AATGGTCTGTTAAAGGGCTGTGG + Intronic
930418607 2:51121009-51121031 TTTGGCCTGTTACTGGGCCTTGG + Intergenic
930932015 2:56896753-56896775 ATTGGTCTGGTGTTTGTCTTGGG - Intergenic
932841318 2:75085411-75085433 ATTGGTCTGTTACTGCGCAATGG + Intronic
932870703 2:75395067-75395089 CCTGGCCTGTTACTGGGCTTTGG - Intergenic
933009450 2:77040668-77040690 ATTGGGCTGATAATGGGTTTAGG + Intronic
933076962 2:77940905-77940927 ATTGTTTTATTATTGAGCTTTGG + Intergenic
935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
935425107 2:102911311-102911333 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
936259288 2:110944410-110944432 ATTTGTGTGTTATGGGGGTTTGG + Intronic
936641228 2:114314706-114314728 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
937785203 2:125887712-125887734 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
937852567 2:126648722-126648744 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
938797689 2:134731953-134731975 ATTAGTCTGGGATGGGGCTTGGG + Intergenic
939061524 2:137428239-137428261 ATTAGTATCTCATTGGGCTTTGG - Intronic
939069065 2:137517872-137517894 CTTGGCCTGTTACTGGGCTTTGG + Intronic
939213875 2:139212256-139212278 CTTGGCCTGTTATTGGGCTTTGG + Intergenic
939788682 2:146546097-146546119 CTTGGCCTGTTACTGGGGTTTGG - Intergenic
940171311 2:150832696-150832718 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
940605913 2:155924272-155924294 CATGGCCTGTTACTGGGCTTTGG - Intergenic
940814431 2:158282471-158282493 GTTGGTCTGTTATTGGTGTATGG - Intronic
941055419 2:160782494-160782516 AATTGTGTGTTATTGGGGTTTGG - Intergenic
941330665 2:164174549-164174571 CTTTGCCTGTTACTGGGCTTTGG - Intergenic
941650982 2:168092778-168092800 ATTGGACTCTTATTGGGATTAGG - Intronic
943006899 2:182395857-182395879 CTTGGCCTGTTATTAGGCTTTGG + Intronic
943239216 2:185362556-185362578 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
943301147 2:186202401-186202423 ATCTGTCCGTTATTGAGCTTGGG - Intergenic
943317926 2:186412303-186412325 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
943385881 2:187203234-187203256 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
943517595 2:188907226-188907248 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
945544871 2:211138173-211138195 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
945642181 2:212443853-212443875 CTTGGACTATTACTGGGCTTTGG + Intronic
945725842 2:213471479-213471501 GTTGGTCTGTTACTGGGCTTTGG - Intronic
946527865 2:220539951-220539973 CTTGGCCCGTTACTGGGCTTTGG - Intergenic
946703772 2:222437776-222437798 CTTGGCCTGTTACTAGGCTTTGG - Intronic
946790924 2:223299776-223299798 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1169640383 20:7744344-7744366 ATTGGTCTGTTACTGTGCAGTGG - Intergenic
1170048852 20:12117363-12117385 ATTGGTCTGTTATTGAAAGTGGG - Intergenic
1170638010 20:18125990-18126012 GTTTGTCTGTTATTGGTGTTAGG - Intergenic
1171216072 20:23353275-23353297 TTTGGTCTGTTGTGGGGCTAGGG - Intronic
1172251111 20:33479883-33479905 ATAGGTCTGTTACTAGGCTGGGG - Intergenic
1175096917 20:56548507-56548529 ATTGGGCTGCTATTGCTCTTAGG + Intergenic
1176791678 21:13326120-13326142 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1176998163 21:15580200-15580222 CTTGGCCTGTTACTGGGCTTCGG + Intergenic
1177139413 21:17342253-17342275 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1177174838 21:17692283-17692305 ATTGCTTTGGTATTTGGCTTGGG - Intergenic
1177505558 21:22014166-22014188 TTTGGCCTGCTACTGGGCTTTGG - Intergenic
1177642295 21:23858941-23858963 ATTTGTCTGTTATTAGGCCCTGG + Intergenic
1177888283 21:26773185-26773207 ACAGGTGTGTTATTGGTCTTTGG + Intergenic
1177913178 21:27056226-27056248 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1177933695 21:27316916-27316938 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1177991069 21:28037122-28037144 TGTGGCCTGTTACTGGGCTTTGG - Intergenic
1178060752 21:28851122-28851144 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1178660598 21:34504358-34504380 AGTGGTTTCTTATTGGGGTTTGG - Intergenic
1178711532 21:34921522-34921544 ATTTGTGTGTCAATGGGCTTGGG + Intronic
1179054007 21:37915091-37915113 ACTGGGCTTTTATTGGGTTTTGG + Intronic
1179415147 21:41192505-41192527 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1181367434 22:22388928-22388950 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1181420656 22:22795847-22795869 GTTGGCCTGTTACTGGGCTTTGG + Intronic
1184443099 22:44530687-44530709 TTTGGGCTGTGATTGGGTTTAGG - Intergenic
1184603558 22:45558359-45558381 CTTGGCCTGTTACTGGGCTTTGG - Intronic
949125662 3:443130-443152 CTTTGCCTGTTACTGGGCTTTGG - Intergenic
949170037 3:986588-986610 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
949245871 3:1924938-1924960 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
949285421 3:2396894-2396916 AGTGGTGTGTTATGGGGTTTAGG + Intronic
949417590 3:3830867-3830889 CTTGGCCTGTTACTAGGCTTTGG - Intronic
949606191 3:5656954-5656976 ATTGGTTTGTTACTGTGCTGAGG - Intergenic
951122574 3:18945582-18945604 CTAGGCCTGTTACTGGGCTTTGG + Intergenic
951291516 3:20876730-20876752 CTTGGCCTATTATTGGGCTTTGG - Intergenic
951384528 3:22027550-22027572 CTTGGCCTGTTACTGGGCTTTGG + Intronic
951560636 3:23962823-23962845 ATTGATCTGAGATTGGGATTAGG + Intronic
951970760 3:28441850-28441872 CTTGGTCTGTTACTGGGCTTTGG - Intronic
952716898 3:36488972-36488994 ATGGATATGTTATAGGGCTTGGG - Intronic
954454308 3:50588858-50588880 AATGGTCAGTTATTGAGCTGTGG - Intergenic
954511488 3:51129646-51129668 CTTGGCCTGTTACTGGGCTTTGG - Intronic
955939055 3:64130763-64130785 ACTGGTCTGGTATTTGGCCTGGG - Intronic
956360455 3:68441453-68441475 CTTGGCCTGTTACTGGGCTTTGG + Intronic
956703892 3:71982872-71982894 CTTGGCCTATTACTGGGCTTTGG - Intergenic
957754600 3:84469441-84469463 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
958487675 3:94732459-94732481 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
959203648 3:103279230-103279252 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
959226776 3:103597261-103597283 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
959746010 3:109777258-109777280 TTTGGACTGTTACTGGGGTTTGG - Intergenic
959997862 3:112698335-112698357 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
960349532 3:116575716-116575738 CTTGGTCTGTTACTGGGCTTTGG + Intronic
961096921 3:124165384-124165406 ATTTGTCTGTTGTGGGGCCTGGG + Intronic
963331814 3:143923358-143923380 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
963453673 3:145516682-145516704 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
963630312 3:147723235-147723257 TCTGGTCTGTTACTGGGCTTTGG + Intergenic
963661396 3:148132160-148132182 CTTGACCTGTTACTGGGCTTTGG + Intergenic
964478062 3:157114773-157114795 ATTGGTTTATTTTTTGGCTTGGG - Intergenic
964679242 3:159318899-159318921 CATGGCCTGTTACTGGGCTTTGG - Intronic
964962491 3:162445157-162445179 ATTTTTCTGTCATTGAGCTTGGG + Intergenic
965226764 3:166000749-166000771 CTTGGCCTGTTAGTGGGCTTTGG - Intergenic
965288396 3:166845590-166845612 ACTGGTCTGTTAGTGGGGGTAGG - Intergenic
966044327 3:175530906-175530928 CTTGGCCTGTTACTGGGCTTTGG - Intronic
966445696 3:179998574-179998596 CTTGGTCTGTTACTGGGCTTTGG + Intronic
967831779 3:193926005-193926027 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
968800186 4:2738136-2738158 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
968906949 4:3457982-3458004 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
971979292 4:33732858-33732880 CTTGGCCTGCTATTGGGCTTTGG - Intergenic
972095496 4:35342704-35342726 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
972805919 4:42529342-42529364 CTTGGCTTGTTACTGGGCTTTGG + Intronic
973118445 4:46489058-46489080 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
973120978 4:46520883-46520905 CTTGGCCTGTTACTGGGCTGTGG - Intergenic
974262368 4:59542254-59542276 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
974605186 4:64142706-64142728 GATAGTCTGTTATTTGGCTTGGG - Intergenic
974644613 4:64674749-64674771 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
974662481 4:64910561-64910583 ATTGATCTGTTTTTGGTATTAGG + Intergenic
974727215 4:65812538-65812560 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
974746912 4:66088890-66088912 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
975386714 4:73767494-73767516 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
976034203 4:80795807-80795829 CTTGGTCTGTTAGTGGGCTTTGG - Intronic
977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG + Intergenic
977430769 4:96928227-96928249 TTTGGCCTCTTACTGGGCTTTGG + Intergenic
977466004 4:97383389-97383411 CTTGGTCTGTTACTGGGCTTTGG + Intronic
977490068 4:97700056-97700078 CTTGGCCTGTTACTGGGCTTTGG - Intronic
977626273 4:99192639-99192661 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
977701728 4:100029872-100029894 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
977833272 4:101618153-101618175 CTTGGCCTGTTACTGGGCTTTGG - Intronic
977930409 4:102743804-102743826 CTTGGCCTGTTACTGGGCTTTGG - Intronic
978341587 4:107725534-107725556 TGTGGCCTGTTACTGGGCTTTGG - Intergenic
978772149 4:112467765-112467787 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
978899072 4:113926803-113926825 CTTGGCCTGTTACTGGGCTTTGG - Intronic
978966855 4:114750957-114750979 CTTGGGCTTTTACTGGGCTTTGG + Intergenic
979767023 4:124474610-124474632 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
979888565 4:126062158-126062180 CTTGGCCTGCTATTGGGCCTTGG - Intergenic
979898399 4:126189042-126189064 CTTGGCCTTTTACTGGGCTTTGG - Intergenic
980385786 4:132087016-132087038 CTCTGTTTGTTATTGGGCTTTGG - Intergenic
980387945 4:132111166-132111188 CTTGGCCTGTTACTGGACTTTGG - Intergenic
980405888 4:132353776-132353798 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
980497524 4:133605347-133605369 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
980957734 4:139445932-139445954 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
981835006 4:149043960-149043982 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
982115038 4:152091401-152091423 ATTGTTCTGTTATGGGTCCTGGG + Intergenic
982623338 4:157732886-157732908 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
982726041 4:158907705-158907727 ATTTGTTTTTTATTGTGCTTGGG + Exonic
982835542 4:160116656-160116678 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
983027393 4:162755310-162755332 CTTGGCCTGTTACTGGGATTTGG + Intergenic
984060281 4:174982009-174982031 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
985003815 4:185512816-185512838 AGTGTTTTGTTATTGGGGTTGGG + Intronic
986037030 5:3950422-3950444 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
986742922 5:10719521-10719543 CTTGGCCTGTTACTGGGCTTTGG + Intronic
986938329 5:12918735-12918757 CTTGGCCTATTACTGGGCTTTGG - Intergenic
987153179 5:15061681-15061703 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
987578339 5:19758296-19758318 CTTGGCCTGTTACTGGACTTTGG - Intronic
987657135 5:20821636-20821658 CTTGGCCTATTACTGGGCTTTGG - Intergenic
987885447 5:23806515-23806537 GTTGGCCTATTACTGGGCTTCGG + Intergenic
988056566 5:26105252-26105274 CTTGGCCTGTTACTCGGCTTTGG - Intergenic
988079828 5:26401404-26401426 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
988160822 5:27516855-27516877 CTAGGCCTGTTACTGGGCTTTGG - Intergenic
988169199 5:27632822-27632844 TTTGGCCAGTTACTGGGCTTTGG - Intergenic
988228771 5:28448142-28448164 CATGGCCTGTTACTGGGCTTTGG + Intergenic
988562133 5:32290863-32290885 CTTGGCCCGTTACTGGGCTTTGG + Intronic
988766416 5:34382312-34382334 CTTGGCCTATTACTGGGCTTTGG + Intergenic
989045203 5:37267575-37267597 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
989457640 5:41661752-41661774 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
989486381 5:41996343-41996365 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
990119468 5:52432080-52432102 ATTGGTCTGTTATTGTGCAGTGG + Intergenic
991033547 5:62105938-62105960 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
991504959 5:67315239-67315261 ATTGCTCTTTTGTGGGGCTTGGG + Intergenic
991946149 5:71900157-71900179 GTTGGCCTGTTACTGGGCTTGGG + Intergenic
992242958 5:74789883-74789905 CTTGGCCTGTTACTGGGCTTTGG + Intronic
992666102 5:79011172-79011194 ATTTGTCTATTATGGGGGTTGGG - Intronic
993231898 5:85247517-85247539 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
993367465 5:87050940-87050962 ATTGGTCTGTTACTGGGCTTTGG - Intergenic
993412579 5:87591796-87591818 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
993586668 5:89739262-89739284 ATTTGTCTGTCATCTGGCTTTGG - Intergenic
994291369 5:98031955-98031977 CTTGGCCTGTTACTGGGGTTTGG - Intergenic
994817963 5:104608880-104608902 ATTGATTTGTTATTAGGCTTAGG - Intergenic
994984417 5:106915713-106915735 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
995776284 5:115727663-115727685 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
996018563 5:118567872-118567894 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
996164953 5:120212492-120212514 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
996825565 5:127677851-127677873 CTTGGCCTGTTATTGGACTTCGG + Intergenic
997132518 5:131291358-131291380 ATTTGTCTGATGTGGGGCTTTGG + Intronic
998290333 5:140908535-140908557 CTTGGCCTATTACTGGGCTTTGG - Intronic
1000223242 5:159234232-159234254 CTTGGCTTGTTACTGGGCTTTGG - Intergenic
1000416975 5:160993918-160993940 CTTGGCCTGTTATTGGGCTTTGG + Intergenic
1001173598 5:169444659-169444681 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1001237371 5:170041755-170041777 ATTTGTCTGTTTTGGGACTTGGG + Intronic
1002885519 6:1290313-1290335 ATTGGCCAGTTATGTGGCTTTGG - Intergenic
1003695895 6:8406123-8406145 CTTGGCCTGTTACAGGGCTTTGG - Intergenic
1004824286 6:19403219-19403241 CTTGGACTGTTACTGGGCTTTGG - Intergenic
1005185172 6:23157089-23157111 GTTGGGCTGTTATTGGGCTTTGG + Intergenic
1006001559 6:30969092-30969114 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1006062354 6:31433239-31433261 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
1006500722 6:34457414-34457436 AATGGTCTGTTTTTAAGCTTAGG + Intergenic
1006626217 6:35399903-35399925 ATTCCTCTATTATTGGGCATTGG + Intronic
1007100736 6:39244658-39244680 TTTGGTCTGATACAGGGCTTGGG + Intergenic
1008266920 6:49439272-49439294 CTTGGCCTGTTACTGGACTTTGG - Intronic
1008698662 6:54072418-54072440 ATGGGTCTGTTACTGGGCAGTGG + Intronic
1009358583 6:62785727-62785749 AATGGTCTTTTATTGTCCTTTGG + Intergenic
1009390109 6:63135061-63135083 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
1009660692 6:66606905-66606927 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1009851924 6:69208941-69208963 CTTGGCCTGTTACTGCGCTTTGG - Intronic
1010325327 6:74556582-74556604 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1010580751 6:77593888-77593910 CTTGGCCTGTTACTGGACTTTGG - Intergenic
1010938243 6:81886400-81886422 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1011039341 6:83013257-83013279 CTTAGCCTGTTACTGGGCTTTGG - Intronic
1011069105 6:83361682-83361704 CCTGGCCTGTTACTGGGCTTTGG + Intronic
1012344591 6:98170336-98170358 GTTGGCCTATTACTGGGCTTTGG + Intergenic
1012730464 6:102874336-102874358 CTTGGCCTGTTACTGGGTTTTGG + Intergenic
1012820807 6:104082935-104082957 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1012920792 6:105219528-105219550 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1013406674 6:109849819-109849841 CTTGGCCAGTTACTGGGCTTTGG + Intergenic
1013537555 6:111077256-111077278 CTAGGTCTGTTGTTGTGCTTAGG - Intergenic
1013564812 6:111347644-111347666 ATTGGTCTATTCTTAGACTTTGG - Intronic
1014363394 6:120508337-120508359 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1014416989 6:121195406-121195428 CTTGGCATGTTACTGGGCTTTGG + Intronic
1014534194 6:122596605-122596627 CTTGGCCTATTACTGGGCTTTGG - Intronic
1014631643 6:123796818-123796840 CTTGACCTGTTACTGGGCTTTGG + Intergenic
1014856237 6:126405077-126405099 ATTGGTCTTATATTGGACATTGG - Intergenic
1015095447 6:129409584-129409606 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1015475752 6:133657508-133657530 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1016085193 6:139904784-139904806 ATTGGACTGTTATAAGTCTTAGG + Intergenic
1016144292 6:140649419-140649441 CTTGGCCTGTTACTGGACTTTGG + Intergenic
1016174912 6:141069078-141069100 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1016419612 6:143870665-143870687 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1016576255 6:145572570-145572592 CTTGGTCTGTTACTGGGCTTTGG - Intronic
1017227804 6:152041075-152041097 CTTGGCCTGTTACTGTGCTTTGG - Intronic
1017977113 6:159368040-159368062 CTTGGTTTGTTACTGGGCTTTGG - Intergenic
1017979705 6:159390066-159390088 ACTGGTCTATTATTTAGCTTGGG + Intergenic
1018122925 6:160655206-160655228 ATTGGTCTGTTATTGGGCTTTGG - Intronic
1018535027 6:164810477-164810499 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1018599890 6:165527543-165527565 ATTGGCCTGGTACTGGGCTTTGG + Intronic
1018803789 6:167242974-167242996 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1020396720 7:7725531-7725553 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1020671687 7:11123150-11123172 ATGGGTGTGGTATTGAGCTTTGG - Intronic
1020710352 7:11597642-11597664 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1021988812 7:26122939-26122961 CTTGGCCTGTTACTGGGCCTTGG + Intergenic
1022078888 7:27000345-27000367 ATTGGCCTGTTACTGGGCTTTGG + Intergenic
1023369178 7:39496042-39496064 ATTAGTATGTAATTGGCCTTTGG - Intergenic
1024025133 7:45403590-45403612 ATTGGTTTGTTACTGGGCAGTGG + Intergenic
1024040540 7:45550161-45550183 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1024470181 7:49761297-49761319 TTTGGGTTGTTTTTGGGCTTTGG - Intergenic
1024701667 7:51910279-51910301 ATTGGTCTGTTACTGGGCAGTGG + Intergenic
1024744209 7:52388460-52388482 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1024866106 7:53906360-53906382 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1027685800 7:81277971-81277993 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1028141738 7:87282000-87282022 CTTGGCCTGTTATTGGGATTTGG + Intergenic
1028187717 7:87807795-87807817 ATTGGTGTGGTATTTGCCTTAGG + Intronic
1028237823 7:88382837-88382859 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1028935016 7:96455079-96455101 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1030245484 7:107380683-107380705 ATTTGTCTGGTCCTGGGCTTTGG - Intronic
1030277460 7:107736130-107736152 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1030368756 7:108674043-108674065 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1031236829 7:119188031-119188053 CTTGGCCTGTTACAGGGCTTTGG + Intergenic
1031676560 7:124618380-124618402 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1032153103 7:129446942-129446964 CTTGGCCTGTTACTGGTCTTTGG - Intronic
1032923468 7:136576100-136576122 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1033076260 7:138253061-138253083 CTTGGCCTCTTACTGGGCTTTGG + Intergenic
1033924311 7:146438769-146438791 ATAGGTTTTTTATTGAGCTTTGG + Intronic
1034540504 7:151755126-151755148 ATCGGCCGGTTATTGGGCGTAGG + Intronic
1038232785 8:25719778-25719800 ATTGGCTTGTTTTTGCGCTTTGG + Intergenic
1039324166 8:36466510-36466532 CTTGGCCTGTTGATGGGCTTTGG - Intergenic
1040560745 8:48521377-48521399 ACTGGTCTATTATTGGACTGTGG - Intergenic
1041523595 8:58781294-58781316 ATTGGTGGCTTATTTGGCTTTGG - Intergenic
1041986184 8:63924488-63924510 CTTGGCCTGTCACTGGGCTTTGG + Intergenic
1042479208 8:69284523-69284545 ATTTGTCTGTTATTGGTGTGTGG - Intergenic
1045221841 8:100207080-100207102 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1046128671 8:109941587-109941609 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1046197560 8:110884238-110884260 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1046417635 8:113937779-113937801 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1046585783 8:116147704-116147726 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1048053940 8:130846327-130846349 AGTGGTCTGTTTCTGGGCCTTGG - Intronic
1048672636 8:136740366-136740388 AGTGGTGTGTAATTTGGCTTCGG + Intergenic
1048808387 8:138262392-138262414 ATTGTTTTCTTATTGGGATTTGG + Intronic
1049077315 8:140408964-140408986 ATTAGTCTTTTATTGCGTTTAGG - Intronic
1049141970 8:140963066-140963088 AGTGGTCTGTTACAGGGCTGAGG - Intronic
1049226822 8:141457191-141457213 ATTCTTCTGTTGTTTGGCTTGGG - Intergenic
1050482677 9:6102618-6102640 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1051791015 9:20802526-20802548 CTTGGACAGTTCTTGGGCTTTGG + Intronic
1051882149 9:21850677-21850699 CTTGGCCTGTTACTGGACTTTGG + Intronic
1052227592 9:26108391-26108413 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1052368654 9:27640851-27640873 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1052561523 9:30089741-30089763 CTTGCCCTGTTACTGGGCTTTGG - Intergenic
1052732644 9:32307606-32307628 ATTGGTCTATTATTGTGCAGAGG + Intergenic
1052954522 9:34243138-34243160 CTTGGTCAGTTGTTGGGCTCTGG + Intronic
1055903937 9:81271189-81271211 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1056156669 9:83845224-83845246 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1056314232 9:85372930-85372952 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1056353869 9:85778303-85778325 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1058019897 9:100076095-100076117 CTTGGCCTGTTAGTGAGCTTTGG + Intronic
1058259253 9:102809653-102809675 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1058576147 9:106404215-106404237 ATTTGTCAGATATTGGCCTTAGG - Intergenic
1059196503 9:112375853-112375875 CTTAGCCTGTTACTGGGCTTTGG - Intergenic
1060080694 9:120641625-120641647 ATAGGTCTGGTGTTGGGCCTAGG + Intronic
1186279498 X:7977133-7977155 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1186384091 X:9091747-9091769 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1186469764 X:9812094-9812116 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1187003852 X:15211410-15211432 ATTGTTCTTTTATTGAGTTTTGG + Intergenic
1187604869 X:20871877-20871899 CTTGGCCTGTTACTGGGGTTTGG + Intergenic
1189154881 X:38746707-38746729 CTTGGCCTGTTACTGGGATTTGG - Intergenic
1189613438 X:42762137-42762159 ATTGATCAGTCATTGGGTTTGGG + Intergenic
1190904270 X:54710603-54710625 ATTGGTTAGTTATTGTGCATTGG + Intergenic
1190996746 X:55617468-55617490 TTTGACCTGTTACTGGGCTTTGG - Intergenic
1191095704 X:56671160-56671182 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1191630035 X:63312574-63312596 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1191932928 X:66394177-66394199 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
1191941258 X:66483851-66483873 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1192096253 X:68214340-68214362 ATGCTTCTGTTCTTGGGCTTTGG - Intronic
1192898706 X:75471923-75471945 CTTGGCCTATTACTGGGCTTTGG + Intronic
1193297784 X:79852687-79852709 CTTGGCCTGTTACTGGGGTTTGG + Intergenic
1193573667 X:83174918-83174940 CTTGGCCTGTTACTGAGCTTTGG - Intergenic
1193832950 X:86310110-86310132 CTTGACCTGTTACTGGGCTTTGG + Intronic
1193914799 X:87351915-87351937 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1193957287 X:87878223-87878245 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1194179588 X:90695922-90695944 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194343312 X:92731097-92731119 GTTGGCCTGTTACTGCGCTTTGG + Intergenic
1194344090 X:92741317-92741339 GTAGGTCTGTTTTTGGGCTCTGG - Intergenic
1194443553 X:93961116-93961138 CTTGGCCTGTTACTGGGCTTGGG + Intergenic
1194513415 X:94822239-94822261 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194604387 X:95961955-95961977 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194755089 X:97729750-97729772 ATGGGTAAGTTATTGGGCATTGG - Intergenic
1194833961 X:98658817-98658839 CTTGGCCTGTTACTGGGATTTGG + Intergenic
1194849243 X:98852161-98852183 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
1195782350 X:108479852-108479874 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1196117652 X:112014877-112014899 GTTGGTCTGGTATGGGGCCTAGG - Intronic
1196135966 X:112209830-112209852 CTTGGACTGTTACTGGGCTTTGG - Intergenic
1197002292 X:121452937-121452959 CATGGTCTGTTACTGGGCCTTGG + Intergenic
1197044417 X:121978338-121978360 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
1197379998 X:125727892-125727914 CTTAGCCTGTTACTGGGCTTAGG - Intergenic
1197405088 X:126039211-126039233 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1197477356 X:126941316-126941338 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1197591868 X:128419400-128419422 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
1197832096 X:130653955-130653977 ATAGGTCTGTAATAGGGCTGAGG - Intronic
1198596420 X:138240850-138240872 ATTGACCTGTTGTTGAGCTTGGG + Intergenic
1198682724 X:139199989-139200011 ATTGGTCTGTTCTTGGGGATAGG - Intronic
1198783037 X:140257784-140257806 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1199144439 X:144348952-144348974 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1199310424 X:146314387-146314409 CTTGGCCCGTTACTGGGCTTTGG - Intergenic
1199430515 X:147754175-147754197 AATGGTCTCTTATTGTCCTTGGG + Intergenic
1200279907 X:154768358-154768380 CTTGGTTTGTTATTGGGAGTTGG + Exonic
1200340492 X:155390629-155390651 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1200521273 Y:4212043-4212065 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1200526250 Y:4278091-4278113 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1200651670 Y:5847762-5847784 CTTGGCCTGTTACTGCGCTTTGG + Intergenic
1200652437 Y:5857973-5857995 GTAGGTCTGTTTTTGGGCTCTGG - Intergenic
1200725967 Y:6667964-6667986 ACTGGACTTTTATTGTGCTTGGG + Intergenic