ID: 1018122926

View in Genome Browser
Species Human (GRCh38)
Location 6:160655212-160655234
Sequence ACAGCTATTGGTCTGTTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 1, 2: 26, 3: 233, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018122926_1018122930 11 Left 1018122926 6:160655212-160655234 CCCAATAACAGACCAATAGCTGT 0: 1
1: 1
2: 26
3: 233
4: 323
Right 1018122930 6:160655246-160655268 AGAGTAGTTATCTGCAGAAGTGG 0: 1
1: 5
2: 5
3: 16
4: 216
1018122926_1018122931 15 Left 1018122926 6:160655212-160655234 CCCAATAACAGACCAATAGCTGT 0: 1
1: 1
2: 26
3: 233
4: 323
Right 1018122931 6:160655250-160655272 TAGTTATCTGCAGAAGTGGCAGG 0: 1
1: 0
2: 3
3: 20
4: 138
1018122926_1018122932 16 Left 1018122926 6:160655212-160655234 CCCAATAACAGACCAATAGCTGT 0: 1
1: 1
2: 26
3: 233
4: 323
Right 1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018122926 Original CRISPR ACAGCTATTGGTCTGTTATT GGG (reversed) Intronic
900434962 1:2625613-2625635 ACAGCTCTTGGCCCGTTACTGGG + Intronic
901785352 1:11621044-11621066 CCAGCCATTGTTCTGTTAATAGG + Intergenic
901904047 1:12392647-12392669 ACAGCTCTTGGCCTGTTACTGGG - Intronic
904179490 1:28655934-28655956 ACAGCTCTTGGCCTATTACTGGG - Intergenic
904335936 1:29798023-29798045 ACAGCTCTTGGCCTATTACTGGG + Intergenic
905354069 1:37368820-37368842 ACAGCTCTTGGCCTGTTACTTGG + Intergenic
905465228 1:38148136-38148158 ACAGCTCTTAGCCTGTTACTGGG + Intergenic
906050492 1:42867451-42867473 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
907780345 1:57560871-57560893 TCAGCTCTTGGCCTGTTACTGGG + Intronic
908038153 1:60078474-60078496 ACAGCTATTCGTCTTTCTTTGGG - Intergenic
909278736 1:73722160-73722182 TCAGCTCTTGGTCTGTTACTAGG + Intergenic
909576924 1:77185895-77185917 ACAGCTCTTGGCCTGTTACTGGG + Intronic
909810957 1:79931374-79931396 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
910141290 1:84030026-84030048 ACAGCTCTTGGCCTGTTACTAGG + Intergenic
910370638 1:86512165-86512187 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
910561904 1:88600018-88600040 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
910630225 1:89346289-89346311 GCAGCTCTTGGCCTGTTACTGGG + Intergenic
910790325 1:91043757-91043779 ACAGCTGTTGGCCTGTTACTGGG + Intergenic
910831094 1:91463387-91463409 ATAGCTCTTGGCCTGTTATTGGG - Intergenic
911109094 1:94164168-94164190 ACAACTCTTGGCCTGTTACTGGG - Intronic
911257321 1:95647327-95647349 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
911738394 1:101361882-101361904 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
911980429 1:104559458-104559480 ACAACTCTTGGCCTGTTACTAGG + Intergenic
911981896 1:104579225-104579247 AAAACTCTTGGCCTGTTATTGGG - Intergenic
911985842 1:104620867-104620889 ACCGCTAGTGTTCTTTTATTAGG - Intergenic
912067026 1:105756984-105757006 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
912129908 1:106588013-106588035 ACAACTCTTGGCCTGTTACTGGG - Intergenic
912252025 1:108021351-108021373 ACAGCTCTTGGGTTGTTACTGGG - Intergenic
912733319 1:112128792-112128814 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
912943809 1:114068167-114068189 ACAGCTTTTAGCCTGTTACTGGG - Intergenic
913039443 1:115008358-115008380 ACAGCTCTTGTCCTGTTACTGGG - Intergenic
913482073 1:119298359-119298381 AAAGAAATTGGTCTGTTATCTGG - Intergenic
915667666 1:157459606-157459628 ACAGCTCTTGGTCTGTTGCGGGG - Intergenic
916106326 1:161435290-161435312 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
916147000 1:161749135-161749157 ACAGATTTTGGGCTTTTATTTGG - Intergenic
916285320 1:163099565-163099587 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
916365964 1:164028050-164028072 ACAGCTCTTGGTCTGCTACTGGG - Intergenic
916557728 1:165907738-165907760 ACAGCCATTGGTCTGCCGTTTGG - Exonic
917217210 1:172690876-172690898 GCAGCTCTTGGTCTGTTACTGGG - Intergenic
917462711 1:175246220-175246242 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
918543476 1:185657061-185657083 ACATATATTTGTCTGTTCTTTGG + Intergenic
918815082 1:189171265-189171287 CCAGCTCTTGGTCTGTTACTGGG + Intergenic
918918228 1:190671842-190671864 ACAGCTCTTGGCCTGTTAATGGG - Intergenic
919241776 1:194924241-194924263 ACAGCTATTGGCCTGTTAATGGG + Intergenic
920197434 1:204238403-204238425 ACACCTGTTGGTCTGTTACTGGG + Intronic
921619823 1:217313174-217313196 ACAGCTCTTGGTCTGCCACTGGG + Intergenic
923253566 1:232199400-232199422 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
923611127 1:235495300-235495322 AAAGCTCTTGGTTTGGTATTAGG + Intronic
923819611 1:237423674-237423696 ACAGATATTGGGATGTTTTTGGG + Intronic
923888934 1:238189546-238189568 ATAGCTATGGTTCTGTTCTTAGG + Intergenic
924840773 1:247707795-247707817 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1064545685 10:16448098-16448120 ACAGCTCTTGGCCAGTTACTGGG - Intronic
1064704194 10:18054574-18054596 AGAGATATTGGTTTGTTATTAGG - Intergenic
1065005329 10:21374201-21374223 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1065399844 10:25286765-25286787 ACAGGAATTGGTCTGGTTTTGGG + Intronic
1065995076 10:31051929-31051951 ACTGCTACTGCTCTGTGATTGGG + Intergenic
1066156046 10:32679201-32679223 ACAATTATTGGCCTTTTATTGGG - Intronic
1066164060 10:32766587-32766609 ACAGTTCTTGGCCTGCTATTGGG + Intronic
1066167024 10:32799193-32799215 TCAGCTCTTGGCCTGTTACTGGG - Intronic
1067518969 10:46980522-46980544 ACAGCTTTTGGCCTGCTACTGGG + Intronic
1067643277 10:48071312-48071334 ACAGCTTTTGGCCTGCTACTGGG - Intergenic
1068007670 10:51409533-51409555 ACAGCTCTTGGCCTGTCACTGGG - Intronic
1068447213 10:57138630-57138652 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1068837213 10:61568341-61568363 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1069145766 10:64890477-64890499 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1069192302 10:65506333-65506355 ACAGCCCTTGGCCTGTTACTGGG - Intergenic
1069790828 10:71019546-71019568 ACAGCCCTTGGCCTGTTACTGGG - Intergenic
1071267083 10:83973965-83973987 ACAGCCCTTGGCCTGTTACTGGG - Intergenic
1071364466 10:84884484-84884506 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
1071673924 10:87637392-87637414 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1071937691 10:90549313-90549335 ACAGCTCTTGGCCTGTTCCTGGG + Intergenic
1071947083 10:90657694-90657716 ATAGCTCTTGGTCTGCTACTGGG - Intergenic
1072360471 10:94654180-94654202 ACAGCTCTTGGACTGTTACTCGG + Intergenic
1073557352 10:104465937-104465959 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1073656678 10:105424447-105424469 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1073903714 10:108252117-108252139 ACAGCTATTTTTTTGATATTTGG + Intergenic
1073918473 10:108432278-108432300 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1073957679 10:108891616-108891638 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1074632511 10:115274013-115274035 ACAGCTCTTAGTCTGCTACTGGG - Intronic
1075606792 10:123817436-123817458 ACAGCACTTGGCCTGTTACTGGG + Intronic
1076277468 10:129214595-129214617 ACAGATATTTGTCTATTATGTGG - Intergenic
1076772626 10:132674802-132674824 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1076927413 10:133499189-133499211 ACAGCTCTTAGCCTGTTACTGGG - Intergenic
1080076596 11:28157532-28157554 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1080976683 11:37350609-37350631 ACAGCTTTTGGCTTGTTACTGGG + Intergenic
1081033079 11:38111333-38111355 CCAGCTTTTATTCTGTTATTTGG - Intergenic
1081065458 11:38534865-38534887 GCAGCTCTTGGCTTGTTATTGGG - Intergenic
1081110480 11:39128430-39128452 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1081609064 11:44547889-44547911 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1085684623 11:78610428-78610450 ACAGCTCTTGGCCTGATACTGGG + Intergenic
1085685965 11:78622201-78622223 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1085747573 11:79128251-79128273 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1086278615 11:85160463-85160485 ACAGCTCTTGGCCTGTTATTGGG + Intronic
1086313771 11:85567210-85567232 ACAGCTATTGGTATTTTGATAGG + Intronic
1086834118 11:91600404-91600426 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1088097207 11:106115169-106115191 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1088151373 11:106749475-106749497 ATAGCTACTGGACTGTTCTTAGG + Intronic
1088191658 11:107234479-107234501 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1088214648 11:107494438-107494460 ACAGCTCTTAGTCTGTCCTTTGG - Intergenic
1088407609 11:109498651-109498673 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1088449356 11:109965379-109965401 ACAGCTCTTGGCCTGTTACCAGG + Intergenic
1088836658 11:113583400-113583422 ACAGCTCTTGGCCTGTCACTGGG + Intergenic
1089903608 11:122013620-122013642 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1090209490 11:124908039-124908061 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1093031868 12:14295938-14295960 ACAGCTGTTGGCCTGTTACTGGG - Intergenic
1093036339 12:14335695-14335717 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1093048922 12:14484956-14484978 ACAGCTCTTGGCCTGTTAACTGG - Intronic
1093049668 12:14490951-14490973 ACAGCTCTTGGCCTGTTAAAGGG - Intronic
1093645731 12:21583682-21583704 AAAGCTCTTGGCCTGTTACTGGG + Intronic
1094102533 12:26779274-26779296 ACAGCTCTTGGTCTGGTACTGGG + Intronic
1095603856 12:44044346-44044368 ACAGCTCTTGGCCTGTTTCTGGG + Intronic
1095809790 12:46360137-46360159 ACAGCTCTGGGTCTTTTTTTGGG - Exonic
1095844393 12:46729956-46729978 ACAGCTCTTGGCCTGTTAATGGG - Intergenic
1095856238 12:46863663-46863685 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1096288714 12:50322972-50322994 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1096457464 12:51799425-51799447 ACGGCTCTTGGCCTGTTACTGGG - Intronic
1097077002 12:56402453-56402475 ACAGCTCTTGACCTGTTACTGGG + Intergenic
1097313935 12:58152124-58152146 ACAGCCCTTGGTCTGCTACTGGG - Intergenic
1097437836 12:59572242-59572264 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1097564646 12:61252417-61252439 ACAGCTCTTGACCTGTTACTGGG - Intergenic
1097821339 12:64131852-64131874 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1097843355 12:64342749-64342771 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1098158370 12:67623629-67623651 ACAGCTTTTGGGCTGCTACTGGG + Intergenic
1098673043 12:73254256-73254278 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1098731053 12:74037360-74037382 ACAGCTGTTGGCCTGTTACTGGG + Intergenic
1098807199 12:75034985-75035007 ACAGCTCTTGGACTGGTACTGGG + Intergenic
1099365926 12:81765396-81765418 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1099375649 12:81893969-81893991 ACAGCTCTTGGCCTGTTACTAGG + Intergenic
1099379380 12:81936528-81936550 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
1099428603 12:82553661-82553683 TCAGGTATTGGTCTGGCATTGGG + Intergenic
1099508563 12:83507199-83507221 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1099578078 12:84405403-84405425 GCAGCTTTTGGCCTGTTACTGGG + Intergenic
1099689782 12:85938049-85938071 ACAGCTCTTTGTCTGTTACTGGG + Intergenic
1100083305 12:90878224-90878246 ACAGCTCTTTGCCTGTTACTGGG + Intergenic
1100231950 12:92617866-92617888 ACAGCTTTTGGCCTGTTATTAGG + Intergenic
1100241150 12:92711596-92711618 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1101534666 12:105606092-105606114 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1101543073 12:105682648-105682670 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1102211233 12:111128677-111128699 ACAGCTCTTGGTTTGCTACTGGG - Intronic
1103396529 12:120611459-120611481 ACAGCTCTTGACCTGTTACTGGG + Intergenic
1105740111 13:23315188-23315210 ACAACTCTTGGCCTGTTACTGGG + Intronic
1107789513 13:43987524-43987546 ACATATATTGGTCTATAATTTGG - Intergenic
1107853702 13:44594269-44594291 ACAGCTTTTATTCTCTTATTTGG + Intergenic
1107983574 13:45755960-45755982 ACAGCTCTTGGCCTATTACTGGG - Intergenic
1108302432 13:49091973-49091995 ACAGCTCTTGGCCCGTTACTGGG - Intronic
1108914300 13:55588859-55588881 ACAGCTCTTGGCATGTTACTAGG - Intergenic
1109293226 13:60500130-60500152 ACGGCTCTTGGCCTGTTACTGGG + Intronic
1109519024 13:63484813-63484835 ACAGCTCTTGGCTTGTTACTGGG + Intergenic
1109583050 13:64366179-64366201 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1109712679 13:66180810-66180832 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1109951022 13:69502193-69502215 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1110041850 13:70770991-70771013 ACAGCTTTTGTTCCCTTATTTGG - Intergenic
1110152732 13:72274463-72274485 ACACCTATTGTTTTGTTACTTGG - Intergenic
1110377174 13:74806481-74806503 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1110834133 13:80064617-80064639 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1111057797 13:82973015-82973037 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1111258172 13:85699641-85699663 CCAGCTATTAGTCCCTTATTTGG + Intergenic
1111317504 13:86581813-86581835 AGAGCTCTTGGCCTGTTACTGGG + Intergenic
1112249925 13:97770266-97770288 ACAGCTCTTGGGCTGTTACTGGG - Intergenic
1113127700 13:106998713-106998735 CCAATTATTGGCCTGTTATTTGG - Intergenic
1114205872 14:20570781-20570803 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1115130695 14:30049272-30049294 ACAGCTCTTGGCCTGTCACTGGG + Intronic
1116058910 14:39896950-39896972 ACAGCTCTTGGCCTGTTGCTGGG + Intergenic
1116068096 14:40009183-40009205 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1116158376 14:41236653-41236675 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1116308042 14:43283435-43283457 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
1116531454 14:45978213-45978235 AGAGCTCTTGGACTGTTACTAGG - Intergenic
1117216845 14:53560187-53560209 ACACCTCTTGGCCTGTTACTGGG + Intergenic
1117634135 14:57724385-57724407 ACAGCTGTTGGCCTGTTACTGGG + Intronic
1117947348 14:61042447-61042469 ACAGCTATAGGTCTGATAACAGG + Intronic
1118122432 14:62860158-62860180 ACAGCTCTTAGCCTGTTACTGGG - Intronic
1118385500 14:65252533-65252555 ACAGCTCTTGGTCTGCTACTGGG - Intergenic
1118880772 14:69824006-69824028 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1119059695 14:71462178-71462200 ACAGCTCTTTGTCTGTTACTGGG - Intronic
1119107562 14:71938827-71938849 ACAGCTCTTGGCCTATTACTGGG - Intronic
1120169408 14:81233998-81234020 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1120343566 14:83254242-83254264 ACATCTATTGCTCTGTTAATTGG - Intergenic
1120453869 14:84706828-84706850 ACAGTTATTGTTTTGTTAGTAGG + Intergenic
1120555990 14:85930426-85930448 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
1120710467 14:87788079-87788101 ACAGCTTTTGGCTTGCTATTGGG - Intergenic
1123765377 15:23472615-23472637 ACAGTTATTGGTCTGCAGTTGGG - Intergenic
1123908496 15:24943642-24943664 ACAGCTGTTGGCCTGCTACTGGG - Intronic
1126043617 15:44617532-44617554 ACAGGTATAGGTCTGTTTCTAGG + Intronic
1126283612 15:46986289-46986311 ACAACTCTTGGCCTGTTATTGGG + Intergenic
1126714525 15:51500725-51500747 AGATCTATTGGTCTGTTTTGCGG - Intronic
1127356918 15:58209201-58209223 ACAGCTCTTGGCCTGTTATTGGG + Intronic
1129553107 15:76474692-76474714 ATGGCTATTAGTCTATTATTTGG + Intronic
1131709273 15:95035174-95035196 CCAGCTATTGCTCTCTTCTTGGG + Intergenic
1131724012 15:95202807-95202829 ACAGCTCTTGGCCTGTTACCGGG + Intergenic
1132305738 15:100810855-100810877 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
1132538090 16:493502-493524 ACAGCTATTGGCCTGTTCTGAGG - Intronic
1140240628 16:73196722-73196744 ACACGTATGGGTCTATTATTTGG - Intergenic
1141315341 16:82957262-82957284 AGAGCTATTGGTCTTTCTTTGGG + Intronic
1141559541 16:84858026-84858048 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1142588380 17:988572-988594 ACAGCTTTTGGACTGCTACTGGG - Intergenic
1146237985 17:31185960-31185982 ACAGCTCTTGACCTGTTACTGGG + Intronic
1146836357 17:36114012-36114034 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1146850935 17:36221052-36221074 ACAGCTCTTAGCCTGTTACTGGG + Intronic
1151247891 17:72809337-72809359 GCGGCAATTGTTCTGTTATTTGG + Intronic
1152804859 17:82350782-82350804 ACAGACACTGGTCTGTTCTTGGG + Intergenic
1153089711 18:1330170-1330192 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1154252670 18:12757267-12757289 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
1154506174 18:15042898-15042920 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1155940709 18:31799606-31799628 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1156303862 18:35858702-35858724 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1156930477 18:42636258-42636280 ACAGATATTAATCTGGTATTTGG + Intergenic
1157341204 18:46780035-46780057 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1157659986 18:49432773-49432795 CCAGCTAATATTCTGTTATTTGG + Intronic
1157870930 18:51229573-51229595 ATAGCTCTTGGTCTGCTACTGGG - Intergenic
1159105278 18:63997182-63997204 ACAATTATTGTCCTGTTATTGGG + Intronic
1159152204 18:64535030-64535052 ACAGCTCTTGGCATGTTACTGGG - Intergenic
1159161575 18:64648652-64648674 CCAGCTTTTATTCTGTTATTTGG + Intergenic
1159287790 18:66375490-66375512 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1159559103 18:69975343-69975365 ACAGCTCTTGGCTTGTTACTGGG - Intergenic
1159711302 18:71764132-71764154 ACAACTCTTGGTTTGTTACTGGG + Intronic
1159719473 18:71869603-71869625 AGAGCTATTTGTTTGTTATTAGG + Intergenic
1160092465 18:75840023-75840045 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1163864908 19:19764892-19764914 ACAGCTTTTGGCCTGTTCCTGGG + Intergenic
1164117256 19:22234566-22234588 ACAACTCTTGGCCTGTTACTGGG - Intergenic
925279954 2:2676876-2676898 ACAGCACTTGGCCTGTTACTGGG + Intergenic
925460728 2:4060454-4060476 ACAGCTCTTTGTCTATTACTGGG + Intergenic
925893473 2:8454605-8454627 CCAGCTATTGGTATGTGACTTGG - Intergenic
926810394 2:16750668-16750690 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
926826764 2:16913676-16913698 ACAGATCTTGGCCTGTTACTGGG + Intergenic
927008719 2:18879732-18879754 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
928947035 2:36780885-36780907 ACAGCCATTTGTGTGTTATAAGG + Intronic
929269824 2:39960773-39960795 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
929550263 2:42886040-42886062 ACAACTCTTGGACTGTTACTGGG + Intergenic
930418606 2:51121003-51121025 ACATCTTTTGGCCTGTTACTGGG + Intergenic
931529959 2:63202625-63202647 AAAGCTGTTGCTGTGTTATTAGG + Intronic
932870705 2:75395073-75395095 ACAGCTCCTGGCCTGTTACTGGG - Intergenic
933265683 2:80178372-80178394 ACAGCTCTTGGCCTGTTACTGGG - Intronic
933394461 2:81713347-81713369 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
933915737 2:86991598-86991620 GCAGCTATCGGTCACTTATTAGG + Intronic
934007256 2:87778304-87778326 GCAGCTATCGGTCACTTATTAGG - Intronic
934034147 2:88074971-88074993 ACAGCTGGTGGTTGGTTATTGGG + Intronic
934954371 2:98605162-98605184 ACAGCTAGCAGTCTGTTATTTGG - Intronic
935183937 2:100714909-100714931 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
935425108 2:102911317-102911339 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
935564307 2:104590243-104590265 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
935770895 2:106419217-106419239 GCAGCTATCGGTCACTTATTAGG - Intronic
935909185 2:107876720-107876742 GCAGCTATCGGTCACTTATTAGG + Intronic
935944628 2:108274355-108274377 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
936130967 2:109841857-109841879 GCAGCTATCGGTCACTTATTAGG + Intronic
936213730 2:110529628-110529650 GCAGCTATCGGTCACTTATTAGG - Intronic
936422868 2:112384188-112384210 GCAGCTATCGGTCACTTATTAGG - Intronic
936641227 2:114314700-114314722 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
937785204 2:125887718-125887740 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
937852568 2:126648728-126648750 ACAGCACTTGGCCTGTTACTGGG - Intergenic
939069064 2:137517866-137517888 GCAGCTCTTGGCCTGTTACTGGG + Intronic
939213874 2:139212250-139212272 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
939788684 2:146546103-146546125 ACAACTCTTGGCCTGTTACTGGG - Intergenic
940171312 2:150832702-150832724 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
940605914 2:155924278-155924300 ACAGCTCATGGCCTGTTACTGGG - Intergenic
941330666 2:164174555-164174577 ACAGCTCTTTGCCTGTTACTGGG - Intergenic
941632497 2:167900147-167900169 ACAGCCATTGGTCAGTTGGTTGG - Intergenic
942202041 2:173581185-173581207 ACAGCTTTTGTTTTGTTTTTTGG + Intergenic
943006898 2:182395851-182395873 ACAGCTCTTGGCCTGTTATTAGG + Intronic
943239217 2:185362562-185362584 ACAACTCTTGGCCTGTTACTGGG - Intergenic
943317927 2:186412309-186412331 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
943388131 2:187227146-187227168 GCAGCTCTTGGCCTGTTACTGGG + Intergenic
943517596 2:188907232-188907254 ACATCTCTTGGCCTGTTACTGGG - Intergenic
945642180 2:212443847-212443869 ACAGCTCTTGGACTATTACTGGG + Intronic
945717833 2:213380659-213380681 ACAGCTCTTGGCCTGTTACTGGG - Intronic
945725843 2:213471485-213471507 ACAGATGTTGGTCTGTTACTGGG - Intronic
946527866 2:220539957-220539979 ACAGCTCTTGGCCCGTTACTGGG - Intergenic
946703773 2:222437782-222437804 ACAGCTCTTGGCCTGTTACTAGG - Intronic
946790923 2:223299770-223299792 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
946798997 2:223389600-223389622 ACAGTTAGTGGTCTTTTATTGGG - Intergenic
1171160253 20:22915968-22915990 AAAACTATTGGTCTGTTTATTGG + Intergenic
1171330070 20:24329661-24329683 ACAGCTTTTGGCCTGTCATTGGG - Intergenic
1172922180 20:38493684-38493706 AGAGCTTTTGGTCTGTCATACGG + Intronic
1175376732 20:58532392-58532414 CCAGCTATTGGTCTGGGCTTAGG + Intergenic
1176597040 21:8757227-8757249 ACACCTATTGGTATGGTATCCGG - Intergenic
1176642854 21:9323172-9323194 ACACCTATTGGTATGGTATCTGG - Intergenic
1176791679 21:13326126-13326148 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1176998162 21:15580194-15580216 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1177139414 21:17342259-17342281 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1177505559 21:22014172-22014194 ACAGCTTTTGGCCTGCTACTGGG - Intergenic
1177521517 21:22233943-22233965 ACAGCTCTTGGTTTGTTACTAGG + Intergenic
1177913177 21:27056220-27056242 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1177933696 21:27316922-27316944 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1177991070 21:28037128-28037150 ACAGCTTGTGGCCTGTTACTGGG - Intergenic
1178060753 21:28851128-28851150 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1178063298 21:28875347-28875369 ACAGCTCTTGGCCTGCTACTGGG - Exonic
1178634468 21:34290207-34290229 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1179415148 21:41192511-41192533 AGAGCTCTTGGCCTGTTACTGGG - Intronic
1180351876 22:11812575-11812597 ACACCTATTGGTATGGTATCTGG - Intergenic
1180370079 22:11976027-11976049 ACACCTATTGGTATGGTATCTGG + Intergenic
1180386328 22:12179495-12179517 ACACCTATTGGTATGGTATCTGG + Intergenic
1180421402 22:12817605-12817627 ACACCTATTGGTATGGTATCTGG + Intergenic
1180591145 22:16938357-16938379 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1181367435 22:22388934-22388956 ACAGCTCTTGGCCTATTACTGGG - Intergenic
1181420655 22:22795841-22795863 ACAGCTGTTGGCCTGTTACTGGG + Intronic
1184603559 22:45558365-45558387 ACAGCTCTTGGCCTGTTACTGGG - Intronic
949170038 3:986594-986616 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
949245870 3:1924932-1924954 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
949417591 3:3830873-3830895 ACAGCTCTTGGCCTGTTACTAGG - Intronic
949445613 3:4131063-4131085 ACAGCTCTTGGCCTGTTACTGGG + Intronic
950807357 3:15617794-15617816 CCATCTATTTGTCTGTTCTTTGG + Intronic
951003620 3:17592861-17592883 ACAGCTTTTGGCCTGTTACTAGG + Intronic
951291517 3:20876736-20876758 ACAGCACTTGGCCTATTATTGGG - Intergenic
951384527 3:22027544-22027566 ACAGCTCTTGGCCTGTTACTGGG + Intronic
951970761 3:28441856-28441878 ACAGCTCTTGGTCTGTTACTGGG - Intronic
954054158 3:48007969-48007991 TCAGCTCTTGGCCTGTTACTGGG + Intronic
954511489 3:51129652-51129674 GCAGCTCTTGGCCTGTTACTGGG - Intronic
956306879 3:67835631-67835653 ACGGTTCTTGGTCTGTTATGGGG + Intergenic
956360454 3:68441447-68441469 ATAGCTCTTGGCCTGTTACTGGG + Intronic
956509663 3:69980381-69980403 ACAGCTCTTGGCCTATTACTGGG + Intergenic
956703893 3:71982878-71982900 ACAGCTCTTGGCCTATTACTGGG - Intergenic
956883356 3:73533754-73533776 TCAGCTATAGGTGTGTTACTGGG + Intronic
956993070 3:74791401-74791423 ACAGCCATTGGTTGGTGATTAGG - Intergenic
957097229 3:75787396-75787418 ACACCTATTGGTATGGTATCTGG + Intergenic
957754599 3:84469435-84469457 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
958487676 3:94732465-94732487 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
959226777 3:103597267-103597289 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
959600590 3:108179506-108179528 ACAGATAATGTTCTTTTATTAGG - Intronic
959746012 3:109777264-109777286 ACAGCTTTTGGACTGTTACTGGG - Intergenic
960349531 3:116575710-116575732 ACAGCTCTTGGTCTGTTACTGGG + Intronic
963331815 3:143923364-143923386 ACAGATCTTGGCCTGTTACTGGG - Intergenic
963453672 3:145516676-145516698 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
963630311 3:147723229-147723251 ACATCTTCTGGTCTGTTACTGGG + Intergenic
964679243 3:159318905-159318927 ACAGCTCATGGCCTGTTACTGGG - Intronic
965226765 3:166000755-166000777 ACAGCTCTTGGCCTGTTAGTGGG - Intergenic
965251331 3:166348258-166348280 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
966044328 3:175530912-175530934 ACAGCTCTTGGCCTGTTACTGGG - Intronic
966445695 3:179998568-179998590 ACAGCTCTTGGTCTGTTACTGGG + Intronic
967831778 3:193925999-193926021 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1202744031 3_GL000221v1_random:81841-81863 ACACCTATTGGTATGGTATCTGG + Intergenic
968800185 4:2738130-2738152 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
968906948 4:3457976-3457998 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
969753684 4:9132942-9132964 ACCGCTACTGGTCTGTTGTCTGG - Intergenic
971776038 4:30966470-30966492 AGAGCTATTACTCTGTAATTTGG - Intronic
971979293 4:33732864-33732886 ACAGCTCTTGGCCTGCTATTGGG - Intergenic
972008762 4:34147750-34147772 AGGGATATTGGTCTTTTATTAGG + Intergenic
972108225 4:35520674-35520696 ACTGCTATTGGATTGTTTTTTGG + Intergenic
972805918 4:42529336-42529358 ACAGCTCTTGGCTTGTTACTGGG + Intronic
972879758 4:43408870-43408892 ATAGCTATAGGTTTGTTATAAGG + Intergenic
973118444 4:46489052-46489074 GCAGCTCTTGGCCTGTTACTGGG + Intergenic
973120979 4:46520889-46520911 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
973360338 4:49159449-49159471 ACACCTATTGGTATGGTATCCGG - Intergenic
973399748 4:49628460-49628482 ACACCTATTGGTATGGTATCTGG + Intergenic
973539874 4:51925071-51925093 ACACCTATTGGCCTGCTAGTGGG - Intergenic
974159918 4:58125112-58125134 CCAGCTTTTAGTCTCTTATTTGG + Intergenic
974262369 4:59542260-59542282 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
974352560 4:60768739-60768761 AGAGATATTGGCCTGTAATTTGG + Intergenic
974644614 4:64674755-64674777 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
974727214 4:65812532-65812554 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
974746913 4:66088896-66088918 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
975024470 4:69531641-69531663 ACAGCTCATGGCCTGTTACTGGG + Intergenic
975386715 4:73767500-73767522 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
975982613 4:80177268-80177290 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
976034204 4:80795813-80795835 ACAGATCTTGGTCTGTTAGTGGG - Intronic
976611191 4:87032246-87032268 ACATCTATTGGTATTTTATATGG - Intronic
977031624 4:91891416-91891438 ACAGCTCTTTTTCTGTTACTGGG + Intergenic
977055540 4:92185788-92185810 AGAGCAATTGGTTAGTTATTTGG + Intergenic
977204718 4:94155693-94155715 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
977430768 4:96928221-96928243 ACAGCTTTTGGCCTCTTACTGGG + Intergenic
977466003 4:97383383-97383405 ACAACTCTTGGTCTGTTACTGGG + Intronic
977490069 4:97700062-97700084 ACAGCTCTTGGCCTGTTACTGGG - Intronic
977626274 4:99192645-99192667 ATAGCTCTTGGCCTGTTACTGGG - Intergenic
977701729 4:100029878-100029900 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
977833273 4:101618159-101618181 ACAGCTCTTGGCCTGTTACTGGG - Intronic
977930410 4:102743810-102743832 ACAGCTCTTGGCCTGTTACTGGG - Intronic
978341588 4:107725540-107725562 ACAGCTTGTGGCCTGTTACTGGG - Intergenic
978772150 4:112467771-112467793 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
978899073 4:113926809-113926831 ACAGCTCTTGGCCTGTTACTGGG - Intronic
978966854 4:114750951-114750973 ACAGCTCTTGGGCTTTTACTGGG + Intergenic
979767022 4:124474604-124474626 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
979888566 4:126062164-126062186 ATAGCTCTTGGCCTGCTATTGGG - Intergenic
980385787 4:132087022-132087044 ACAGCTCTCTGTTTGTTATTGGG - Intergenic
980405889 4:132353782-132353804 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
980497525 4:133605353-133605375 ACAGCTCTTGGCCTGTTATTGGG - Intergenic
980629524 4:135414295-135414317 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
980957733 4:139445926-139445948 ACAGCTTTTGGCCTGTTACTGGG + Intergenic
981835005 4:149043954-149043976 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
981873539 4:149515205-149515227 GCAGCTCTTGGCCTGTTACTAGG + Intergenic
982623339 4:157732892-157732914 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
982835541 4:160116650-160116672 AGAGCTCTTGGCCTGTTACTGGG + Intergenic
982847771 4:160274305-160274327 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
982890941 4:160849246-160849268 ACAGCAACTTCTCTGTTATTTGG + Intergenic
983027392 4:162755304-162755326 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
983582677 4:169324821-169324843 ACAGCTCTTGGCTTGTTACTGGG + Intergenic
983971485 4:173880554-173880576 ACAGCTATGGTTCTAATATTTGG + Intergenic
984023989 4:174521766-174521788 ACAGCTATTGGGCTGTCAGAAGG + Intronic
984060282 4:174982015-174982037 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
984441725 4:179779382-179779404 ACAGATTTTGGTCTGCTCTTGGG + Intergenic
986037031 5:3950428-3950450 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
986087111 5:4462727-4462749 ACAGCTCTTGGCCTGTTAGTGGG + Intergenic
986742921 5:10719515-10719537 ACAGCTCTTGGCCTGTTACTGGG + Intronic
986938330 5:12918741-12918763 ACAGCTCTTGGCCTATTACTGGG - Intergenic
987153178 5:15061675-15061697 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
987468187 5:18296975-18296997 ACAGCTCTTGGCCTATTACTGGG - Intergenic
988056567 5:26105258-26105280 ACAGCTCTTGGCCTGTTACTCGG - Intergenic
988079829 5:26401410-26401432 ACAACTCTTGGCCTGTTACTGGG - Intergenic
988091594 5:26547718-26547740 ACAGCTATTCTTCTTTAATTTGG - Intergenic
988188777 5:27901246-27901268 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
988228770 5:28448136-28448158 ACAGCTCATGGCCTGTTACTGGG + Intergenic
988324194 5:29740457-29740479 ACAGCTAAAGCACTGTTATTGGG + Intergenic
988562132 5:32290857-32290879 ACAGCTCTTGGCCCGTTACTGGG + Intronic
989045204 5:37267581-37267603 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
989097832 5:37797330-37797352 ACAGCTTTTGGAATGTTACTAGG + Intergenic
989118246 5:37977622-37977644 ACCGCCATTGATTTGTTATTTGG + Intergenic
989457641 5:41661758-41661780 ACAGCTCTTGGCCTGTTACTAGG - Intergenic
989486382 5:41996349-41996371 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
989679025 5:44007539-44007561 ACAGCTCTTGGAGTGCTATTGGG - Intergenic
990164702 5:52981708-52981730 GCTGCTGTTGGCCTGTTATTTGG - Intergenic
991033546 5:62105932-62105954 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
991234169 5:64375173-64375195 ACAGCTTTTGGCCTATTACTGGG + Intergenic
991934354 5:71787158-71787180 CCAGCTCTTGGTCTGAAATTTGG + Intergenic
991946147 5:71900151-71900173 ACAGCTGTTGGCCTGTTACTGGG + Intergenic
992242957 5:74789877-74789899 ACAGTTCTTGGCCTGTTACTGGG + Intronic
993231899 5:85247523-85247545 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
993367466 5:87050946-87050968 ACAGCTATTGGTCTGTTACTGGG - Intergenic
994218060 5:97160810-97160832 ATAGCCATTGGTCTGTTCTTTGG - Intronic
994291371 5:98031961-98031983 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
994534057 5:101005882-101005904 ACAGCAATTGGTGAGTTATATGG - Intergenic
994855433 5:105113574-105113596 ACAGCTCTTGGCATGTTACTGGG - Intergenic
994984418 5:106915719-106915741 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
995427731 5:112043716-112043738 AAAGCTCTTGGCCTGTTACTGGG - Intergenic
995776285 5:115727669-115727691 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
996018562 5:118567866-118567888 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
996164954 5:120212498-120212520 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
996392201 5:122973775-122973797 ACAGCTCTTGGCCTGTTACTTGG - Intronic
996912234 5:128668984-128669006 ACAGCTCTTGGCCTGTTACTGGG + Intronic
997162774 5:131626319-131626341 ACAGCTATTGGTATGGTTTGTGG - Intronic
997181720 5:131835928-131835950 ACAGGTAGAGGTTTGTTATTAGG + Intronic
998284091 5:140841720-140841742 ACAGCTTTTGGTCTTTTACCCGG - Exonic
998290334 5:140908541-140908563 ACAGCTCTTGGCCTATTACTGGG - Intronic
999242290 5:150134912-150134934 CCAGCTGTGGGTCTGTTACTCGG + Exonic
999351387 5:150874855-150874877 ACAGCTCTTGGCCTGTCACTGGG + Intronic
1000223243 5:159234238-159234260 ACAGCTCTTGGCTTGTTACTGGG - Intergenic
1000416974 5:160993912-160993934 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
1000887338 5:166761675-166761697 AAATCTAGTTGTCTGTTATTTGG - Intergenic
1001173597 5:169444653-169444675 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1001217539 5:169869788-169869810 AAAGTTATTGGTGTGCTATTTGG - Intronic
1003695896 6:8406129-8406151 ACAGCTCTTGGCCTGTTACAGGG - Intergenic
1003758609 6:9150092-9150114 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1003791222 6:9550002-9550024 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1004824287 6:19403225-19403247 ACAGCTCTTGGACTGTTACTGGG - Intergenic
1005185171 6:23157083-23157105 ACAGCTGTTGGGCTGTTATTGGG + Intergenic
1006001558 6:30969086-30969108 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1006062353 6:31433233-31433255 ACAGCTCTTAGCCTGTTACTGGG + Intergenic
1009390110 6:63135067-63135089 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1009660693 6:66606911-66606933 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1010323579 6:74540500-74540522 ACACCTCTTGGCCTGTTACTGGG + Intergenic
1010325328 6:74556588-74556610 ACATCTCTTGGCCTGTTACTGGG - Intergenic
1010740292 6:79495008-79495030 ACTGCTATTGGTCTGTGACCTGG + Intronic
1010760386 6:79715872-79715894 ACATCTATTTCTCTGTTATTAGG + Intergenic
1010938244 6:81886406-81886428 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1011069103 6:83361676-83361698 ACAGCTCCTGGCCTGTTACTGGG + Intronic
1012622050 6:101357364-101357386 ACAGCTGTTTATCTGATATTTGG + Intergenic
1012730463 6:102874330-102874352 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1012820806 6:104082929-104082951 ACAGTTCTTGGCCTGTTACTGGG + Intergenic
1012920793 6:105219534-105219556 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1014363395 6:120508343-120508365 AGAGCTCTTGGCCTGTTACTGGG - Intergenic
1014393899 6:120900091-120900113 TCAGCTCTTTGTCTGTCATTTGG + Intergenic
1014416988 6:121195400-121195422 ACAGCTCTTGGCATGTTACTGGG + Intronic
1014972131 6:127829586-127829608 ACAGTTCTTGTTCTGTTCTTAGG + Exonic
1015095448 6:129409590-129409612 ACAACTCTTGGCCTGTTACTGGG - Intronic
1015466848 6:133557706-133557728 ACAGCTCTTCGTCTGTTACCAGG - Intergenic
1015475751 6:133657502-133657524 ACAGCTCTTGGCTTGTTACTGGG + Intergenic
1015820855 6:137258997-137259019 ATAGCCAATGGTCTGTTGTTGGG - Intergenic
1016132837 6:140497996-140498018 ACAGCTCTTGGCCTGTAATTGGG - Intergenic
1016147328 6:140692705-140692727 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1016174913 6:141069084-141069106 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1016419613 6:143870671-143870693 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1016576256 6:145572576-145572598 ACAGCTCTTGGTCTGTTACTGGG - Intronic
1017044068 6:150330843-150330865 ACAGCTCTTGGCCTGCTACTGGG - Intergenic
1017388455 6:153912196-153912218 ACAGCTCTTGGCCTGTTACCAGG - Intergenic
1017977114 6:159368046-159368068 ACAGTTCTTGGTTTGTTACTGGG - Intergenic
1018122926 6:160655212-160655234 ACAGCTATTGGTCTGTTATTGGG - Intronic
1018326004 6:162669718-162669740 GCAGCTATTCCTCTGGTATTTGG + Intronic
1018599889 6:165527537-165527559 ACAGCTATTGGCCTGGTACTGGG + Intronic
1018803790 6:167242980-167243002 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1018850838 6:167589183-167589205 ACAGCTTTTGGTCGGTTTCTTGG - Intergenic
1020396719 7:7725525-7725547 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1020710351 7:11597636-11597658 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1021988811 7:26122933-26122955 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1022078887 7:27000339-27000361 ACAGCTATTGGCCTGTTACTGGG + Intergenic
1022878039 7:34555536-34555558 ACAGCTATGGCTGTATTATTAGG + Intergenic
1024040539 7:45550155-45550177 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1024744208 7:52388454-52388476 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1027685799 7:81277965-81277987 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1027799767 7:82736453-82736475 AATGCTCTTGGCCTGTTATTGGG + Intergenic
1028029236 7:85888402-85888424 GCAGTTATTTGTCTGTGATTGGG + Intergenic
1028095720 7:86757857-86757879 ACAGATATTGGACTGTTAACTGG - Intronic
1028141737 7:87281994-87282016 ACAGCTCTTGGCCTGTTATTGGG + Intergenic
1028237822 7:88382831-88382853 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1028935015 7:96455073-96455095 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1030368755 7:108674037-108674059 ACAGATCTTGGCCTGTTACTGGG + Intergenic
1030457462 7:109793042-109793064 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1031236828 7:119188025-119188047 ACAGCTCTTGGCCTGTTACAGGG + Intergenic
1031676559 7:124618374-124618396 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1032923469 7:136576106-136576128 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1037364592 8:18108260-18108282 ACAGCTCTTGGCATGTTACTTGG - Intergenic
1041867610 8:62595285-62595307 ACAGCTAATGGTATGCTTTTTGG - Intronic
1042130996 8:65586727-65586749 ACAGCTATCTGTTTGTTCTTGGG + Intergenic
1043232515 8:77820894-77820916 ACAGCTGTTGGCCTGCTACTCGG - Intergenic
1044285972 8:90412437-90412459 ACAGCTCTTGTTCTGCTACTGGG - Intergenic
1044487149 8:92767113-92767135 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1045221840 8:100207074-100207096 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1045984194 8:108229282-108229304 AAAGCTATAGGTCTTTTAGTAGG - Intronic
1046128672 8:109941593-109941615 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1046197559 8:110884232-110884254 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1046384814 8:113495466-113495488 ACAGCTCTTGGTCTGCTACTAGG + Intergenic
1046417636 8:113937785-113937807 ACAGGTCTTGGCCTGTTACTGGG - Intergenic
1046585784 8:116147710-116147732 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1050482676 9:6102612-6102634 ACAGCTCTTGGCCTATTACTGGG + Intergenic
1052227591 9:26108385-26108407 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1052368651 9:27640845-27640867 ACAGCCCTTGGCCTGTTACTAGG + Intergenic
1055382981 9:75729346-75729368 ACAGCTCATGGTCTGTTTTATGG - Intergenic
1056156668 9:83845218-83845240 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1056314233 9:85372936-85372958 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1056353870 9:85778309-85778331 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1056421401 9:86431093-86431115 ACATGTATTGTGCTGTTATTGGG + Intergenic
1057058998 9:91986599-91986621 ACAGCTCTTGGCCTGCTACTGGG + Intergenic
1058544164 9:106042741-106042763 ACAGCTCTTGGCCTATTACTGGG - Intergenic
1059196504 9:112375859-112375881 ACAGCTCTTAGCCTGTTACTGGG - Intergenic
1203689376 Un_GL000214v1:28542-28564 ACACCTATTGGTATGGTATCTGG - Intergenic
1203712663 Un_KI270742v1:111807-111829 ACACCTATTGGTATGGTATCTGG + Intergenic
1203556258 Un_KI270743v1:210126-210148 ACACCTATTGGTATGGTATCTGG + Intergenic
1203646899 Un_KI270751v1:75511-75533 ACACCTATTGGTATGGTATCTGG + Intergenic
1186279497 X:7977127-7977149 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1186384092 X:9091753-9091775 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1186469765 X:9812100-9812122 AAAGCTCTTGGCCTGTTACTGGG - Intronic
1187604867 X:20871871-20871893 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1187852369 X:23603816-23603838 ACATTTATTGTTCTGTTCTTTGG - Intergenic
1189154882 X:38746713-38746735 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1190255321 X:48758147-48758169 ACAGCTCTTGGTCTGCTACTGGG + Intergenic
1190601536 X:52097826-52097848 ACAGCTCTTGGTCTGCTACTGGG - Intergenic
1190721635 X:53153602-53153624 ACAGCTCTTGATCTGCTACTGGG - Intergenic
1191009347 X:55744628-55744650 ACAGTTCTTGGTTTGCTATTAGG - Intronic
1191134032 X:57044479-57044501 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1191630036 X:63312580-63312602 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1191631294 X:63324887-63324909 ACAGCTTTTGGCCTGTTACTTGG + Intergenic
1191658803 X:63629798-63629820 ACAGCTCTTGGCTTGTTACTGGG - Intergenic
1191742538 X:64451300-64451322 ACAGCTATTGGCCTGTTACTGGG - Intergenic
1191769493 X:64740090-64740112 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1191932927 X:66394171-66394193 ACAGCTTTTGGCCTGTTACTGGG + Intergenic
1191946355 X:66539019-66539041 ACTGCTCTTGGTCTGTTACTGGG + Intergenic
1192898705 X:75471917-75471939 ACAGCTCTTGGCCTATTACTGGG + Intronic
1192996194 X:76515585-76515607 ACAGCTCTTGGCATGTTACTGGG + Intergenic
1193053492 X:77125775-77125797 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1193297782 X:79852681-79852703 ACAGTTCTTGGCCTGTTACTGGG + Intergenic
1193356257 X:80523130-80523152 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1193572512 X:83161477-83161499 AAGGCTATAGGTTTGTTATTTGG - Intergenic
1193832949 X:86310104-86310126 ACAGCTCTTGACCTGTTACTGGG + Intronic
1193914800 X:87351921-87351943 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1193957286 X:87878217-87878239 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1194179589 X:90695928-90695950 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1194443551 X:93961110-93961132 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1194482726 X:94446573-94446595 ACAGCATTTGGCCTGCTATTGGG + Intergenic
1194513416 X:94822245-94822267 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1194604388 X:95961961-95961983 ACAGCTTTTGGCCTGTTACTGGG - Intergenic
1194849244 X:98852167-98852189 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
1195228470 X:102822278-102822300 ACAGCTCTTGGCCTGCTAATGGG + Intergenic
1195782351 X:108479858-108479880 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1196135967 X:112209836-112209858 ACAGCTCTTGGACTGTTACTGGG - Intergenic
1197002291 X:121452931-121452953 ATAGCTCATGGTCTGTTACTGGG + Intergenic
1197044416 X:121978332-121978354 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1197097470 X:122612845-122612867 ACAGGTTTTGGCCTGTTACTGGG + Intergenic
1197245044 X:124158987-124159009 ACAGCTCTTGGCCTGTTACTGGG - Intronic
1197339262 X:125245716-125245738 ACATCTTTTGGTCATTTATTAGG + Intergenic
1197372054 X:125637859-125637881 GCAGCTCTTGGCCTGTTACTGGG - Intergenic
1197379999 X:125727898-125727920 ACAGCTCTTAGCCTGTTACTGGG - Intergenic
1197477357 X:126941322-126941344 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1198682726 X:139199995-139200017 AGAAATATTGGTCTGTTCTTGGG - Intronic
1198701302 X:139400303-139400325 ACGGCTCTTGGCCTGTTACTGGG + Intergenic
1198783038 X:140257790-140257812 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1198867087 X:141134894-141134916 ACAGTTATAGATCTCTTATTTGG - Intergenic
1198934042 X:141887886-141887908 ACAGCTCTTGGCCTGTTACTGGG + Intronic
1199024381 X:142919726-142919748 ACAGCTCTTGGACTGTTACCGGG + Intergenic
1199040593 X:143111107-143111129 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1199144440 X:144348958-144348980 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1199310425 X:146314393-146314415 ACAGCTCTTGGCCCGTTACTGGG - Intergenic
1200340493 X:155390635-155390657 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1200521272 Y:4212037-4212059 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1200526251 Y:4278097-4278119 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1201798429 Y:17926706-17926728 ACAGCTCTTGGCCTGTTACTGGG + Intergenic
1201803124 Y:17979251-17979273 ACAGCTCTTGGCCTGTTACTGGG - Intergenic
1202075032 Y:21028810-21028832 CCAGCTTTTATTCTGTTATTTGG + Intergenic
1202359749 Y:24095396-24095418 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1202511029 Y:25574718-25574740 ACAACTCTTGGCCTGTTACTGGG - Intergenic