ID: 1018122932

View in Genome Browser
Species Human (GRCh38)
Location 6:160655251-160655273
Sequence AGTTATCTGCAGAAGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018122927_1018122932 15 Left 1018122927 6:160655213-160655235 CCAATAACAGACCAATAGCTGTC 0: 1
1: 0
2: 23
3: 213
4: 262
Right 1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG No data
1018122926_1018122932 16 Left 1018122926 6:160655212-160655234 CCCAATAACAGACCAATAGCTGT 0: 1
1: 1
2: 26
3: 233
4: 323
Right 1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG No data
1018122925_1018122932 22 Left 1018122925 6:160655206-160655228 CCAAAGCCCAATAACAGACCAAT 0: 1
1: 1
2: 26
3: 215
4: 333
Right 1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG No data
1018122924_1018122932 25 Left 1018122924 6:160655203-160655225 CCACCAAAGCCCAATAACAGACC 0: 1
1: 24
2: 162
3: 164
4: 206
Right 1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG No data
1018122929_1018122932 4 Left 1018122929 6:160655224-160655246 CCAATAGCTGTCTCTCAAAAGGA 0: 3
1: 195
2: 220
3: 170
4: 280
Right 1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018122932 Original CRISPR AGTTATCTGCAGAAGTGGCA GGG Intronic
No off target data available for this crispr