ID: 1018127815

View in Genome Browser
Species Human (GRCh38)
Location 6:160698427-160698449
Sequence TGCAAGCTGGACTGCATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018127815_1018127821 29 Left 1018127815 6:160698427-160698449 CCAGCAATGCAGTCCAGCTTGCA No data
Right 1018127821 6:160698479-160698501 TTGGCTGCATTTTCCACTTCAGG No data
1018127815_1018127819 10 Left 1018127815 6:160698427-160698449 CCAGCAATGCAGTCCAGCTTGCA No data
Right 1018127819 6:160698460-160698482 TCGCCTAGGAAGTTGTGACTTGG 0: 1
1: 2
2: 1
3: 2
4: 56
1018127815_1018127818 -4 Left 1018127815 6:160698427-160698449 CCAGCAATGCAGTCCAGCTTGCA No data
Right 1018127818 6:160698446-160698468 TGCATGGACGTGCTTCGCCTAGG 0: 1
1: 0
2: 2
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018127815 Original CRISPR TGCAAGCTGGACTGCATTGC TGG (reversed) Intergenic