ID: 1018127815 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:160698427-160698449 |
Sequence | TGCAAGCTGGACTGCATTGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018127815_1018127821 | 29 | Left | 1018127815 | 6:160698427-160698449 | CCAGCAATGCAGTCCAGCTTGCA | No data | ||
Right | 1018127821 | 6:160698479-160698501 | TTGGCTGCATTTTCCACTTCAGG | No data | ||||
1018127815_1018127819 | 10 | Left | 1018127815 | 6:160698427-160698449 | CCAGCAATGCAGTCCAGCTTGCA | No data | ||
Right | 1018127819 | 6:160698460-160698482 | TCGCCTAGGAAGTTGTGACTTGG | 0: 1 1: 2 2: 1 3: 2 4: 56 |
||||
1018127815_1018127818 | -4 | Left | 1018127815 | 6:160698427-160698449 | CCAGCAATGCAGTCCAGCTTGCA | No data | ||
Right | 1018127818 | 6:160698446-160698468 | TGCATGGACGTGCTTCGCCTAGG | 0: 1 1: 0 2: 2 3: 3 4: 63 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018127815 | Original CRISPR | TGCAAGCTGGACTGCATTGC TGG (reversed) | Intergenic | ||