ID: 1018127817

View in Genome Browser
Species Human (GRCh38)
Location 6:160698440-160698462
Sequence CGAAGCACGTCCATGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 2, 3: 0, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018127817_1018127821 16 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127821 6:160698479-160698501 TTGGCTGCATTTTCCACTTCAGG No data
1018127817_1018127823 28 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127823 6:160698491-160698513 TCCACTTCAGGTGAGATGGAAGG No data
1018127817_1018127819 -3 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127819 6:160698460-160698482 TCGCCTAGGAAGTTGTGACTTGG 0: 1
1: 2
2: 1
3: 2
4: 56
1018127817_1018127822 24 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127822 6:160698487-160698509 ATTTTCCACTTCAGGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018127817 Original CRISPR CGAAGCACGTCCATGCAAGC TGG (reversed) Intergenic
906965586 1:50453314-50453336 CCAAGCAGGGCCATGCGAGCTGG + Intronic
908152374 1:61315520-61315542 AGAAGGACTTCCATGCAACCTGG + Intronic
923437167 1:233978316-233978338 TGAATCACGTTCATGCAATCAGG - Intronic
924833037 1:247617588-247617610 CAATGCACATCCATGAAAGCAGG + Intergenic
1067415027 10:46096337-46096359 GGACACACGTCCATGCAGGCAGG - Intergenic
1077518697 11:3018263-3018285 GGAAGCACCTCCATGCTAGTGGG - Intronic
1112381633 13:98896286-98896308 CCAATCACGTCCATGTCAGCAGG - Intronic
1118247626 14:64126760-64126782 AGAAGCAAGTCCCTGAAAGCTGG + Exonic
1126840056 15:52709127-52709149 CAAAGCACATCCAGGCAAGTGGG + Intronic
1130972520 15:88744641-88744663 AGAAGCACATCCATGCAGGGGGG + Intergenic
1135487468 16:22878812-22878834 GGAAGCACTTCCATGCAGGGTGG + Intronic
1142167898 16:88602834-88602856 AGAAGCACCTTCATGCAGGCAGG + Intronic
1160349600 18:78165258-78165280 GGCAGCACGTCGATGCCAGCAGG - Intergenic
1167505527 19:49869223-49869245 CGAAGCCCGTCCCTGCATCCAGG - Exonic
932808749 2:74806185-74806207 TGAAGCATGTCCCTGCAAGGAGG - Intergenic
933918965 2:87025616-87025638 TGATGCACGTCCATGCAAGCTGG + Intergenic
934004029 2:87744298-87744320 TGATGCACGTCCATGCAAGCTGG - Intergenic
1172772306 20:37388892-37388914 GGAAGGACGTGCATGCAGGCGGG - Intronic
949311857 3:2708688-2708710 GAGAGCACGTCCATGCACGCAGG + Intronic
1007180026 6:39923153-39923175 AGAAGCAGGTCACTGCAAGCGGG + Intronic
1018127817 6:160698440-160698462 CGAAGCACGTCCATGCAAGCTGG - Intergenic
1018148669 6:160918475-160918497 TGACGCACGTCCGTGCAGGCTGG + Intergenic
1018914203 6:168122836-168122858 CCAAACACGGCCATGGAAGCTGG - Intergenic
1034827786 7:154282292-154282314 AGAAGCATGTCCCTGCATGCAGG - Intronic
1049504715 8:142989950-142989972 CACAGCACGTCCATGCATGGGGG + Intergenic
1062480656 9:136749347-136749369 AGGAGCACGTCCATGCAACAAGG + Intergenic