ID: 1018127817

View in Genome Browser
Species Human (GRCh38)
Location 6:160698440-160698462
Sequence CGAAGCACGTCCATGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 2, 3: 0, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018127817_1018127821 16 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127821 6:160698479-160698501 TTGGCTGCATTTTCCACTTCAGG No data
1018127817_1018127823 28 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127823 6:160698491-160698513 TCCACTTCAGGTGAGATGGAAGG No data
1018127817_1018127819 -3 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127819 6:160698460-160698482 TCGCCTAGGAAGTTGTGACTTGG 0: 1
1: 2
2: 1
3: 2
4: 56
1018127817_1018127822 24 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127822 6:160698487-160698509 ATTTTCCACTTCAGGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018127817 Original CRISPR CGAAGCACGTCCATGCAAGC TGG (reversed) Intergenic