ID: 1018127820

View in Genome Browser
Species Human (GRCh38)
Location 6:160698463-160698485
Sequence CAGCCAAGTCACAACTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018127820_1018127822 1 Left 1018127820 6:160698463-160698485 CCTAGGAAGTTGTGACTTGGCTG No data
Right 1018127822 6:160698487-160698509 ATTTTCCACTTCAGGTGAGATGG No data
1018127820_1018127821 -7 Left 1018127820 6:160698463-160698485 CCTAGGAAGTTGTGACTTGGCTG No data
Right 1018127821 6:160698479-160698501 TTGGCTGCATTTTCCACTTCAGG No data
1018127820_1018127825 28 Left 1018127820 6:160698463-160698485 CCTAGGAAGTTGTGACTTGGCTG No data
Right 1018127825 6:160698514-160698536 TTGAACTCTACCTCACCTCCTGG 0: 1
1: 2
2: 1
3: 5
4: 120
1018127820_1018127823 5 Left 1018127820 6:160698463-160698485 CCTAGGAAGTTGTGACTTGGCTG No data
Right 1018127823 6:160698491-160698513 TCCACTTCAGGTGAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018127820 Original CRISPR CAGCCAAGTCACAACTTCCT AGG (reversed) Intergenic
No off target data available for this crispr