ID: 1018127821

View in Genome Browser
Species Human (GRCh38)
Location 6:160698479-160698501
Sequence TTGGCTGCATTTTCCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018127820_1018127821 -7 Left 1018127820 6:160698463-160698485 CCTAGGAAGTTGTGACTTGGCTG No data
Right 1018127821 6:160698479-160698501 TTGGCTGCATTTTCCACTTCAGG No data
1018127815_1018127821 29 Left 1018127815 6:160698427-160698449 CCAGCAATGCAGTCCAGCTTGCA No data
Right 1018127821 6:160698479-160698501 TTGGCTGCATTTTCCACTTCAGG No data
1018127817_1018127821 16 Left 1018127817 6:160698440-160698462 CCAGCTTGCATGGACGTGCTTCG 0: 1
1: 0
2: 2
3: 0
4: 23
Right 1018127821 6:160698479-160698501 TTGGCTGCATTTTCCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018127821 Original CRISPR TTGGCTGCATTTTCCACTTC AGG Intergenic