ID: 1018127822 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:160698487-160698509 |
Sequence | ATTTTCCACTTCAGGTGAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018127820_1018127822 | 1 | Left | 1018127820 | 6:160698463-160698485 | CCTAGGAAGTTGTGACTTGGCTG | No data | ||
Right | 1018127822 | 6:160698487-160698509 | ATTTTCCACTTCAGGTGAGATGG | No data | ||||
1018127817_1018127822 | 24 | Left | 1018127817 | 6:160698440-160698462 | CCAGCTTGCATGGACGTGCTTCG | 0: 1 1: 0 2: 2 3: 0 4: 23 |
||
Right | 1018127822 | 6:160698487-160698509 | ATTTTCCACTTCAGGTGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018127822 | Original CRISPR | ATTTTCCACTTCAGGTGAGA TGG | Intergenic | ||