ID: 1018127824

View in Genome Browser
Species Human (GRCh38)
Location 6:160698492-160698514
Sequence ACCTTCCATCTCACCTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018127824_1018127825 -1 Left 1018127824 6:160698492-160698514 CCACTTCAGGTGAGATGGAAGGT 0: 1
1: 2
2: 0
3: 12
4: 141
Right 1018127825 6:160698514-160698536 TTGAACTCTACCTCACCTCCTGG 0: 1
1: 2
2: 1
3: 5
4: 120
1018127824_1018127830 18 Left 1018127824 6:160698492-160698514 CCACTTCAGGTGAGATGGAAGGT 0: 1
1: 2
2: 0
3: 12
4: 141
Right 1018127830 6:160698533-160698555 CTGGTGAGGTTGATGTTTCCTGG No data
1018127824_1018127826 4 Left 1018127824 6:160698492-160698514 CCACTTCAGGTGAGATGGAAGGT 0: 1
1: 2
2: 0
3: 12
4: 141
Right 1018127826 6:160698519-160698541 CTCTACCTCACCTCCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018127824 Original CRISPR ACCTTCCATCTCACCTGAAG TGG (reversed) Intergenic