ID: 1018129769

View in Genome Browser
Species Human (GRCh38)
Location 6:160717959-160717981
Sequence ATTCATTGTAGGGCTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018129760_1018129769 28 Left 1018129760 6:160717908-160717930 CCTGCAGCCATCCTCCTTAACAT 0: 1
1: 0
2: 0
3: 14
4: 214
Right 1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG No data
1018129762_1018129769 17 Left 1018129762 6:160717919-160717941 CCTCCTTAACATCCATCTGTGCA 0: 1
1: 0
2: 0
3: 20
4: 175
Right 1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG No data
1018129761_1018129769 21 Left 1018129761 6:160717915-160717937 CCATCCTCCTTAACATCCATCTG 0: 1
1: 0
2: 1
3: 16
4: 312
Right 1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG No data
1018129764_1018129769 5 Left 1018129764 6:160717931-160717953 CCATCTGTGCATTCTCTATTTTA 0: 1
1: 0
2: 2
3: 25
4: 465
Right 1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG No data
1018129763_1018129769 14 Left 1018129763 6:160717922-160717944 CCTTAACATCCATCTGTGCATTC 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG No data
1018129759_1018129769 29 Left 1018129759 6:160717907-160717929 CCCTGCAGCCATCCTCCTTAACA 0: 1
1: 0
2: 0
3: 14
4: 204
Right 1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018129769 Original CRISPR ATTCATTGTAGGGCTGGGCA CGG Intronic
No off target data available for this crispr