ID: 1018130102

View in Genome Browser
Species Human (GRCh38)
Location 6:160721825-160721847
Sequence CTTCTGCTTCATTGCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 2, 2: 3, 3: 15, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018130095_1018130102 29 Left 1018130095 6:160721773-160721795 CCTTCTGATGGAACTTGTACCTG 0: 2
1: 0
2: 1
3: 7
4: 98
Right 1018130102 6:160721825-160721847 CTTCTGCTTCATTGCAATGCAGG 0: 1
1: 2
2: 3
3: 15
4: 160
1018130100_1018130102 10 Left 1018130100 6:160721792-160721814 CCTGTGGTGGGTTTGGAAAGAAA 0: 1
1: 1
2: 3
3: 22
4: 188
Right 1018130102 6:160721825-160721847 CTTCTGCTTCATTGCAATGCAGG 0: 1
1: 2
2: 3
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018130102 Original CRISPR CTTCTGCTTCATTGCAATGC AGG Intronic
900743922 1:4347396-4347418 TTACTGTCTCATTGCAATGCAGG - Intergenic
908123209 1:61005131-61005153 TTTCTTCTGCATTGAAATGCAGG - Intronic
909586138 1:77290874-77290896 CTACTGCTTGATTTCACTGCTGG - Intronic
911223606 1:95278636-95278658 CTTCTGCTTTATGGTAGTGCTGG + Intergenic
911514572 1:98851583-98851605 CTTCTGCAACATTGCCCTGCAGG + Intergenic
914854630 1:151342371-151342393 CTTCTGCTTCTTTGGTATGCTGG + Exonic
915642007 1:157235018-157235040 CATCTGCTGCATCGGAATGCAGG - Intergenic
920060294 1:203222600-203222622 CTCCTGCTACATTGCTATTCTGG + Intronic
1064904781 10:20333975-20333997 CTTCTCCTGCCTTCCAATGCCGG + Intergenic
1065673455 10:28147802-28147824 CTTCTGATTTATTGCAAGGAGGG + Intronic
1066243386 10:33559280-33559302 CATCTGCTGCAATGCATTGCTGG + Intergenic
1067177232 10:43958613-43958635 CATCTGCTTCTTTGCACTGTGGG - Intergenic
1068465706 10:57387606-57387628 GTTCTGCTTCATAGCACTGAGGG + Intergenic
1069421985 10:68254768-68254790 CTTCTGCTACATTCCACTGTTGG - Intergenic
1069912962 10:71771032-71771054 CTTCTCCTTCATAGCAAACCAGG - Intronic
1071390398 10:85169003-85169025 CATCTGCATCATTGCAAGGTTGG + Intergenic
1071477896 10:86040665-86040687 CTTCTGATCCATTGCAAAGTAGG + Intronic
1073697134 10:105882468-105882490 CTTCAGCTTCAGTTCATTGCAGG + Intergenic
1073922705 10:108478061-108478083 CTTCTACTTGATTGTAATGTAGG - Intergenic
1074375582 10:112938582-112938604 CTTCCTTTTCATTGCAAAGCAGG + Intergenic
1076299229 10:129412083-129412105 TTTCTGCTTCAGTACCATGCTGG - Intergenic
1080684149 11:34501714-34501736 CTTCTGCTTGGCTGCACTGCAGG - Intronic
1083574372 11:63779081-63779103 TTTCTTCTTCCTTGGAATGCTGG - Intergenic
1084266185 11:68006514-68006536 CTCCTGTGTCAGTGCAATGCGGG - Intergenic
1086889585 11:92241306-92241328 CTTTTGCTTCTTAGCATTGCAGG + Intergenic
1088751460 11:112845557-112845579 CTTTTGCCTCATTTAAATGCTGG - Intergenic
1089818106 11:121194801-121194823 CTTGTACTTCATTGCAATTTGGG + Intergenic
1092857556 12:12688932-12688954 GTATTTCTTCATTGCAATGCAGG - Intronic
1093960888 12:25271605-25271627 CTTCTGCCTGATTCCAAAGCTGG - Intergenic
1094275142 12:28666457-28666479 CTTCTGCTTCATTACAAGTTTGG - Intergenic
1094276466 12:28681761-28681783 CTACTACTTCATTTCCATGCTGG - Intergenic
1096969592 12:55655118-55655140 CTTCTCCTTCATGGCCATGACGG + Intergenic
1098452778 12:70639082-70639104 CTTCTCCTTCCTTCCATTGCAGG + Exonic
1100808057 12:98308477-98308499 CTTCTGGTTCACTGGAAAGCTGG + Intergenic
1103187416 12:118971237-118971259 CTTCTGCTTCAAAGCATTCCAGG + Intergenic
1104495578 12:129234168-129234190 CAGCTGCTTTAATGCAATGCAGG + Intronic
1107628388 13:42315994-42316016 CCACTGCTTCTTTGCACTGCTGG - Intronic
1109692219 13:65909143-65909165 CTACTGCTTCTTGTCAATGCTGG + Intergenic
1110463262 13:75770833-75770855 TCTCTGCCTCATTGCAATTCAGG - Intronic
1111711205 13:91816500-91816522 CTTCTACTTGATTTCAATGCTGG - Intronic
1112047880 13:95616058-95616080 CTTTTGCTTCAGTGTAATGTAGG + Intronic
1112726981 13:102315934-102315956 TTTCTGCTTTTTTGCAGTGCTGG - Intronic
1113181741 13:107636180-107636202 CTTCTGCTTCTTCGCTGTGCAGG - Intronic
1115032235 14:28810664-28810686 CTTCTGCTTGACTGAAATGTTGG + Intronic
1115328464 14:32168047-32168069 CTTGTGCCTCATTGCTATGTAGG - Intergenic
1116172962 14:41426664-41426686 CATCTGCTGCATTGGAATGCAGG + Intergenic
1118553859 14:66990343-66990365 CTTTTACTTCATTAAAATGCTGG + Intronic
1119298207 14:73550200-73550222 CCTCAGTTTCATTGCTATGCAGG - Intronic
1124189977 15:27566093-27566115 CTTCTGCTTCATTGCCAAGATGG + Intergenic
1126857689 15:52854776-52854798 CTTCTGCCCCATGGCACTGCTGG - Intergenic
1127616592 15:60691977-60691999 CTTCTCCTACATGGCAATTCAGG + Intronic
1127941277 15:63698743-63698765 CTGCTGTTCCATTGCAATGATGG + Exonic
1128391578 15:67186216-67186238 CTTCTGCTTCTTGGCTCTGCTGG + Intronic
1129189372 15:73928234-73928256 CTTCTCCCTCATTTCAATGAGGG + Intronic
1131488462 15:92841697-92841719 TGTCTTCTTCATTGCAATGGAGG - Intergenic
1131751396 15:95511798-95511820 TTTCTGCTTCTTTGCATTCCTGG + Intergenic
1132082073 15:98874759-98874781 GTTCTGCTTCACTGCAGAGCTGG - Intronic
1133718945 16:8476133-8476155 CTTCTGGCTTATTGCAATGGAGG + Intergenic
1137934947 16:52625845-52625867 ATTTTCCTTCATTGCAATGGTGG - Intergenic
1138318968 16:56094636-56094658 CTTCTACTTCAGTGAAATTCTGG - Intergenic
1139726888 16:68907431-68907453 CATCTTCATCACTGCAATGCAGG - Exonic
1203141586 16_KI270728v1_random:1770816-1770838 CATCTGCTGCATTGGAATCCAGG + Intergenic
1142708733 17:1711907-1711929 ATTTTTCTCCATTGCAATGCTGG + Intergenic
1144805040 17:17959492-17959514 CTTCTGATTCTTTGAATTGCTGG + Intronic
1146438067 17:32869968-32869990 CTACTGGTTCATTTCATTGCAGG - Intronic
1147839546 17:43361655-43361677 CTTCGGCTTCATTGCCCTTCAGG + Intergenic
1148259784 17:46171404-46171426 CTACTGCTTCCTTGAAGTGCCGG + Exonic
1150000702 17:61437171-61437193 CTTCTTCTTCTTTCCAGTGCTGG + Intergenic
1152391591 17:80007031-80007053 CGTGTGCTTCAGTGCAAGGCTGG - Intronic
1154016392 18:10621802-10621824 CTTCTGCTGTAGTGCAATGTAGG - Intergenic
1154189119 18:12213865-12213887 CTTCTGCTGTAGTGCAATGTAGG + Intergenic
1157738465 18:50071415-50071437 CATCTGCTTCAGTGCTTTGCAGG - Intronic
1158081667 18:53599849-53599871 CTTGAGCTGCATTGCTATGCTGG + Intergenic
1158256781 18:55559793-55559815 CTTCTGTTTAATTGTAAGGCAGG - Intronic
1158651634 18:59293564-59293586 CTCCTGCTTCATTGTACTGTAGG + Intronic
1167213059 19:48145642-48145664 CTGCTGCCTCATTGTAATGCCGG - Intronic
925595064 2:5547482-5547504 TTTCTGCTTCATGGAAATGAAGG + Intergenic
929541950 2:42829386-42829408 CTGCTGCCCCACTGCAATGCTGG - Intergenic
930113496 2:47698820-47698842 CATCTGCTGCATTGGAATGCAGG - Intronic
931959942 2:67471049-67471071 CTTCAGCTTCACTGCACTACAGG + Intergenic
935181902 2:100699249-100699271 CTTCTGCCACATGGCTATGCTGG + Intergenic
935517800 2:104064690-104064712 CTTCTGGCTCAGTGAAATGCTGG - Intergenic
937385068 2:121422064-121422086 CTTCTGCTTACATGAAATGCTGG + Intronic
939369779 2:141284160-141284182 CTTCTTTTTTATTGCACTGCTGG - Intronic
941840423 2:170077043-170077065 TTTCTGCTTCACTGCTATTCCGG - Intronic
942537370 2:176979061-176979083 CTTTTGCTTTATTGATATGCAGG - Intergenic
943066749 2:183095440-183095462 GTTCTTGTTCATTGTAATGCAGG + Exonic
943609230 2:190013098-190013120 CTTTGGCATCATTGTAATGCTGG + Intronic
946053645 2:216883475-216883497 TTTCTGCTTCTTTGTAATGTGGG - Intergenic
947221996 2:227802713-227802735 CATCACCTCCATTGCAATGCTGG - Intergenic
948251325 2:236532201-236532223 CTTCAGCTTCCTTGCTCTGCAGG - Intergenic
1168889039 20:1281940-1281962 CCTCTGCCCCATGGCAATGCAGG - Intronic
1169551687 20:6707837-6707859 CTTCTGCATCATTCAAAAGCTGG - Intergenic
1170120906 20:12910654-12910676 TTGCTGATTCATTGCAATGAGGG - Intergenic
1174876572 20:54232708-54232730 CTGTTCCTTCATTGCAATGGTGG - Intergenic
1176902716 21:14462530-14462552 CATCTGCTGCATTGGAGTGCAGG + Intergenic
1177139060 21:17339274-17339296 CTTCTGCTCCCTTGCAAGGGAGG - Intergenic
1180135464 21:45859390-45859412 CTTCTGATGCATAGCCATGCAGG - Intronic
1181384069 22:22530704-22530726 TTTCTGCCTGATGGCAATGCTGG + Intergenic
949825012 3:8156225-8156247 CTTCTGTTCCATTTCAAAGCTGG - Intergenic
951454204 3:22872367-22872389 CTTCTACTTGATTGCAGTCCAGG - Intergenic
952003790 3:28818264-28818286 CTTCTGCTTCATTGTAACTATGG + Intergenic
958920839 3:100103651-100103673 CTTCTAATACAGTGCAATGCTGG - Intronic
965347940 3:167575325-167575347 CTGCTTCTTCATTGAGATGCAGG + Intronic
966924097 3:184633413-184633435 TTTCTGCTCCTTTTCAATGCTGG - Intronic
969140272 4:5065004-5065026 CTCCTTCTTCTTTGCAAGGCTGG + Intronic
970726940 4:19058161-19058183 CATCTGCTGCATGGCAAAGCAGG + Intergenic
974419650 4:61656907-61656929 CTTCTGCTGCATTTCTAAGCTGG + Intronic
977171648 4:93769381-93769403 CTCCTGCTTCATAGCCATGCTGG + Exonic
978929047 4:114288144-114288166 ATCCAGCTTCATTGCATTGCTGG - Intergenic
980222046 4:129930164-129930186 CATCTGCTGCATCGGAATGCAGG - Intergenic
981754375 4:148125276-148125298 TTTCAGCTTCCTTGCCATGCTGG + Intronic
984708250 4:182863494-182863516 TTTCTGTTTCTTTGCAATGCAGG + Intergenic
986088819 5:4481400-4481422 GTTCTGCTTCATTGCACCGCTGG - Intergenic
988975918 5:36515661-36515683 CTTGTGCTGCATTGCAATCTAGG + Intergenic
989952421 5:50315537-50315559 CTTATGCTTCATTGCCAAGTGGG - Intergenic
992825113 5:80541651-80541673 ATTCTGTTTTATTTCAATGCAGG + Exonic
994221200 5:97197337-97197359 CTTCTGTTTCATTTCAAGGCTGG + Intergenic
994871601 5:105357398-105357420 CTTCTGCTTCATTGGCATATTGG + Intergenic
995281281 5:110338513-110338535 CATCTGCTGCATCGGAATGCAGG + Intronic
1002022353 5:176371946-176371968 CTGCTGCTTCATTGCCAGACTGG + Exonic
1003734412 6:8862100-8862122 TTTCTGCAACATTGCAATGATGG + Intergenic
1004729700 6:18345724-18345746 CTTCTGCCTCATGGCAATAATGG - Intergenic
1008939301 6:57029253-57029275 CATCTGCTGCATCGCAATGCAGG - Intergenic
1011676978 6:89744266-89744288 TTTTTGCTTCATTGCATTGAGGG - Intronic
1016685394 6:146876284-146876306 CTTCGGCTTTATTGAATTGCTGG + Intergenic
1016798740 6:148146701-148146723 CTTCTTCCTCAATGCAAAGCAGG - Intergenic
1018105055 6:160477856-160477878 CTTCTGCTTTGTTGCAATGCAGG - Intergenic
1018106474 6:160492121-160492143 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018107323 6:160501529-160501551 CTTCTGCTTTATTGCAATGCAGG - Intergenic
1018113167 6:160556752-160556774 CTTCTGCTTTGTTGCAATGCAGG - Intronic
1018118502 6:160612300-160612322 CTTCTCCTTTACTGCAATTCAGG - Intronic
1018120904 6:160634491-160634513 CTTCTCCTTTACTGCAATTCAGG - Intronic
1018122630 6:160651072-160651094 CGTCTGCTATGTTGCAATGCAGG - Intronic
1018130102 6:160721825-160721847 CTTCTGCTTCATTGCAATGCAGG + Intronic
1018148175 6:160912887-160912909 CATCTGCTTTGTTGCAATGCAGG + Intergenic
1020919307 7:14242299-14242321 CTACTGCTTCTTTGCCCTGCAGG - Intronic
1021836527 7:24682012-24682034 TTCCTGCTTCTTTGCAATCCTGG + Intronic
1022041138 7:26582457-26582479 CTGCTGCTTAATTCCAAAGCTGG - Intergenic
1022264288 7:28738674-28738696 CTTCTGCTTCACTGGAACACAGG - Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1028410341 7:90523705-90523727 GTTCTGCTCCATTGCAAGGCTGG + Intronic
1029410398 7:100406105-100406127 CCTCTGCTCAATTGCAAGGCTGG + Intronic
1035394729 7:158527458-158527480 CTCCTGCTTCAGTGCCATGGAGG + Intronic
1035405837 7:158596621-158596643 CTTTTGCTAAGTTGCAATGCTGG - Intergenic
1036997279 8:13672954-13672976 ATTCTGCTTCTTTGCAATGCTGG + Intergenic
1037772114 8:21808395-21808417 CTCCTCCATCATAGCAATGCTGG - Intronic
1037877083 8:22553573-22553595 CTTCTGCCTCATCCCAAGGCTGG - Intronic
1039539781 8:38355365-38355387 ATTATCATTCATTGCAATGCTGG + Intronic
1040600856 8:48882834-48882856 CATCTGATTCAGTTCAATGCTGG + Intergenic
1040720493 8:50315812-50315834 ATTGTGCTTGATTGCAGTGCAGG - Intronic
1041284856 8:56249670-56249692 CTTCTTCTTCTTTGTATTGCTGG + Intergenic
1041821206 8:62035633-62035655 CATCTGCTTTATTGAAATACTGG - Intergenic
1043239155 8:77909665-77909687 TTTCTTCTACAATGCAATGCTGG - Intergenic
1043244280 8:77978280-77978302 CTTCTGCAACATAGCAAGGCAGG - Intergenic
1046569164 8:115940984-115941006 TTTCTGCTTCCTTGTAATTCTGG + Intergenic
1047479393 8:125266771-125266793 CTTGTGTTTCCTTGCAATTCAGG + Intronic
1047548816 8:125847353-125847375 TTTTTGCTCCATTGAAATGCAGG + Intergenic
1049450190 8:142656947-142656969 CTTCTGCCTCATGGCAGTGCTGG - Intergenic
1049450479 8:142658822-142658844 CTTCTGCCACATGGCAGTGCTGG - Exonic
1049499024 8:142951490-142951512 CTGCTGCCTCATCTCAATGCAGG + Intergenic
1050023215 9:1306679-1306701 CTCCTTCTTCATTGCCATGGAGG - Intergenic
1050597930 9:7222988-7223010 CTTCTGTTTCATTTGATTGCTGG + Intergenic
1050919212 9:11179404-11179426 TTTCTGCTTCTTTGCATTACTGG + Intergenic
1052101224 9:24448309-24448331 CTTCTGCATCCTTCCAATGTGGG + Intergenic
1053538071 9:38945970-38945992 CTTAGGTTTCATTGCTATGCAGG + Intergenic
1054628063 9:67417951-67417973 CTTAGGTTTCATTGCTATGCAGG - Intergenic
1056993266 9:91430574-91430596 CCTCTGCTTCAATGGAATGTGGG - Intergenic
1058950837 9:109902497-109902519 CTTTTACTTCATTACAATGATGG - Intronic
1059077575 9:111210279-111210301 CTACTGCTTAATTGCTATGTTGG - Intergenic
1059188027 9:112294584-112294606 CTTGTTCTTAATTGCAATGGAGG - Intronic
1059668848 9:116474744-116474766 TTTCTTTTTCATTGCAATGAGGG - Intronic
1187198683 X:17113747-17113769 TTTCTCCTCCATTCCAATGCTGG - Intronic
1188971307 X:36618891-36618913 CTGCTGCTTCTTTGCAAAACTGG - Intergenic
1189688724 X:43593119-43593141 CTTCTACTTCATTGGCATGTGGG + Intergenic
1190682088 X:52835072-52835094 CTTCTGGTTCATTGCCATGGCGG + Intergenic
1190909747 X:54759759-54759781 CATCGGCTTCCATGCAATGCAGG + Exonic
1194228359 X:91290736-91290758 CTTTTGTATCATGGCAATGCTGG - Intergenic
1195001945 X:100650615-100650637 GTTCTGCTGCCTTACAATGCAGG + Intronic
1198964300 X:142210890-142210912 CTCCTGCCTCATTGCAAGGATGG - Intergenic
1199143291 X:144335782-144335804 CTTCTGCCTTATTGCAAGGACGG + Intergenic