ID: 1018130334

View in Genome Browser
Species Human (GRCh38)
Location 6:160724596-160724618
Sequence ATGTTTACACAGAAGAATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018130333_1018130334 -6 Left 1018130333 6:160724579-160724601 CCAGAAGAAGAAAATATATGTTT 0: 1
1: 0
2: 4
3: 84
4: 839
Right 1018130334 6:160724596-160724618 ATGTTTACACAGAAGAATAGTGG 0: 1
1: 0
2: 1
3: 27
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018130334 Original CRISPR ATGTTTACACAGAAGAATAG TGG Intronic
905812704 1:40924577-40924599 ATGTATATACCGAAGAATAACGG + Intergenic
909138031 1:71826625-71826647 TTCTTTACACAGAAAAAAAGGGG - Intronic
909458035 1:75872168-75872190 ATGTTTGCATAGAAGAATCTGGG - Intronic
910440156 1:87243540-87243562 ATGTTTAGAATGAAGAATGGGGG - Intergenic
911821187 1:102425310-102425332 AAATTTACAAAGAAGAAAAGAGG + Intergenic
913570430 1:120114503-120114525 AAGTTTCCAAAGAAGGATAGGGG - Intergenic
914291235 1:146275481-146275503 AAGTTTCCAAAGAAGGATAGGGG - Intergenic
914398084 1:147289822-147289844 GGGTTTAGGCAGAAGAATAGAGG + Intronic
914424699 1:147564776-147564798 CTGTTTCAACAGAAGAATAAAGG - Intronic
914552279 1:148726264-148726286 AAGTTTCCAAAGAAGGATAGGGG - Intergenic
917125189 1:171681064-171681086 ATGTTGACATAGAAGGAAAGGGG + Intergenic
917218529 1:172703016-172703038 ATGTTGACAGAGAAAAACAGAGG + Intergenic
917266023 1:173221813-173221835 TTCTTTACACAGTAGCATAGAGG + Intergenic
918026048 1:180747733-180747755 ATATGTACAAAGAAAAATAGAGG + Intronic
918028800 1:180782439-180782461 ATGCTTGCAAAGAAGAAAAGAGG - Intronic
918582827 1:186151972-186151994 ATTTTTAAAAAGAAGAAAAGAGG - Intronic
918656986 1:187039377-187039399 ATGTAGACAAAGAAGAATAGAGG + Intergenic
918729542 1:187973824-187973846 ATGATTACAAAGAATATTAGTGG + Intergenic
919286216 1:195563545-195563567 AGGCTTACAGAGTAGAATAGTGG + Intergenic
920153508 1:203929211-203929233 ATGTTAGCAAAGAAAAATAGAGG + Intergenic
921096201 1:211889300-211889322 ATGTGGACACAGAAAGATAGTGG - Intergenic
921993419 1:221391822-221391844 ATTTTTACGCAGAAAGATAGAGG + Intergenic
924420252 1:243902409-243902431 AAGTGTACACAGAACAGTAGAGG - Intergenic
1063685593 10:8234517-8234539 AAGTTTACATAGAAGGAGAGAGG - Intergenic
1066405839 10:35117209-35117231 ATGTTTAGCTAGAAGAATTGCGG + Intergenic
1067291657 10:44948005-44948027 ATCTTTGCACAGAAGAGAAGAGG + Intergenic
1067983055 10:51109277-51109299 ATGTTTAAAAAGAAGAAAAAAGG + Intronic
1068276354 10:54803567-54803589 ATCTTTAGACAAATGAATAGTGG - Intronic
1068278003 10:54827910-54827932 ATGTTTAAAAAGAAGTTTAGTGG - Intronic
1068621714 10:59192164-59192186 ATGTTTACCCAAAATAACAGAGG + Intronic
1068626217 10:59251031-59251053 GGGTTGACACAGAAAAATAGAGG + Intronic
1069040648 10:63692296-63692318 ATGTTCACACATATGAATTGAGG - Intergenic
1069765945 10:70859942-70859964 AAGTATACACAGATAAATAGGGG - Intronic
1070772087 10:79088435-79088457 ATGTTTACCCAGCAGAAGGGTGG - Intronic
1071064394 10:81613867-81613889 ATGATCACACAGAGGAAAAGTGG - Intergenic
1071966769 10:90859254-90859276 ATGTGTACAGGGAAGAATATGGG - Intergenic
1073057660 10:100712680-100712702 TTGTTTACAGAGATGAACAGTGG - Intergenic
1074743954 10:116512709-116512731 ATATTGACAGAGTAGAATAGTGG + Intergenic
1077693837 11:4375357-4375379 ATGTTACCACAGAAGATTTGTGG + Intergenic
1078032071 11:7762842-7762864 ATTTTTACATACAACAATAGAGG + Intergenic
1079170326 11:18088032-18088054 ATGTTTACACAGAAACATGAAGG + Intronic
1080309103 11:30868742-30868764 ATATTTACTCAGCAGCATAGAGG - Intronic
1080313083 11:30917266-30917288 ATGTTTACTCAGAAAAAAATGGG + Intronic
1080729531 11:34935412-34935434 GTGCTTATACAGAAGGATAGAGG + Intronic
1080844477 11:36014883-36014905 ATGTTTAAACAAAAGAAGGGGGG + Intronic
1081559613 11:44201272-44201294 AGGTCTAAACAGAAGAATATGGG - Intronic
1083019207 11:59489081-59489103 ATACTTATACAGAAGAATATTGG - Intergenic
1083576192 11:63793560-63793582 ATGTGTGCATAGAAGAATTGTGG + Intergenic
1085025001 11:73231185-73231207 ATGTTTACTCAGAAGGAAGGGGG - Intronic
1086907771 11:92436628-92436650 ATATTTGCACATAAGAAGAGTGG - Intronic
1087091652 11:94279846-94279868 ATTTTTACCCAGAAGAAATGAGG + Intergenic
1087163317 11:94973096-94973118 ATGTATACAAAGAAGAAAACAGG + Intronic
1088023024 11:105142821-105142843 ATGTTTATACCCAAGAACAGAGG - Intergenic
1088769991 11:113024783-113024805 ATTTTTAGACAAAAAAATAGAGG - Intronic
1089319701 11:117617113-117617135 ATGTTTGCAGAGAAGAAGATGGG + Intronic
1090876495 11:130793188-130793210 ATGATTAAACAGAAGTATACAGG - Intergenic
1091093939 11:132799912-132799934 ATGTTCACACAGAAATATAAGGG - Intronic
1092519139 12:9248713-9248735 ATGTTTACATTGGAGAATAGTGG - Intergenic
1092944805 12:13442851-13442873 ATGTGCACACAGATGACTAGAGG - Intergenic
1093576726 12:20739606-20739628 TGGCTTACACAGAAGAAGAGAGG + Intronic
1094559754 12:31540995-31541017 ATCTTTACGCAGAAGAATGAAGG + Intronic
1095657804 12:44691083-44691105 CTGTTTAAAAAGAAGAATACAGG + Intronic
1096961292 12:55580558-55580580 AAGATGACACAGAAGAATCGAGG + Intergenic
1097523291 12:60696608-60696630 ATTTTTACACACAATAACAGAGG + Intergenic
1097829907 12:64213349-64213371 ATGCATACACAAAAGAATATGGG + Intronic
1098453663 12:70648637-70648659 ATGGTCACACAGAAAATTAGGGG + Intronic
1099323005 12:81175397-81175419 AGGTAAACACAGAATAATAGTGG + Intronic
1100358954 12:93858753-93858775 AGTGTTACACAGAAGAATGGTGG - Intronic
1100409500 12:94300914-94300936 ATGTTTACCCAGAAGCGAAGAGG - Exonic
1102848537 12:116215235-116215257 ATGTTCACTTAGAGGAATAGAGG - Intronic
1105500641 13:20968527-20968549 ATTTTTACAGAGAAAAATGGAGG + Intergenic
1105818204 13:24056144-24056166 ATGTTGAAACAGTTGAATAGAGG + Intronic
1106057948 13:26255349-26255371 ATTTTTACATAGAACAATGGGGG + Intronic
1106954408 13:34920020-34920042 ATGTTAAAATAGAGGAATAGTGG - Intergenic
1107372665 13:39769610-39769632 ATGTTAAAACTGAAGAGTAGAGG + Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1109408801 13:61937377-61937399 ATGTTGACAGAGAAGATCAGTGG - Intergenic
1110315759 13:74104237-74104259 CTGTTTCCACAGAGGAATAACGG - Intronic
1111043083 13:82777007-82777029 ATGATTACACAGAAGGAAAATGG - Intergenic
1112047486 13:95612966-95612988 ATGTTTACCGAGAAAAAGAGGGG + Intronic
1112665079 13:101560950-101560972 ATTCTTACACTGAAGAAAAGTGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112990002 13:105501626-105501648 AAGTATACACAAAAGAATTGCGG - Intergenic
1113106380 13:106775876-106775898 ATGTTTACACATAAGAAAGGAGG - Intergenic
1114242934 14:20885781-20885803 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114245326 14:20907807-20907829 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114249861 14:20949718-20949740 ATATTTTCACAGAAGAATAAAGG + Intergenic
1115009743 14:28530767-28530789 ATGTGACCACAGAAGAATAATGG - Intergenic
1115041274 14:28932015-28932037 ATGGACAAACAGAAGAATAGTGG - Intergenic
1115110367 14:29813927-29813949 ATGTTTACCCAGAGGTACAGAGG - Intronic
1116174653 14:41452059-41452081 ATGTTGAAACTGAAGAAAAGCGG - Intergenic
1116451691 14:45074228-45074250 GTGTTTGCACACAAAAATAGGGG - Exonic
1116870291 14:50063602-50063624 ACTTTTACAAAGAAGAGTAGAGG + Intergenic
1117020446 14:51565131-51565153 CTGTGTACACAGAAGAACAAAGG - Intronic
1117788020 14:59307742-59307764 ATGGTTATACAGGAGAATAGTGG + Intronic
1118418470 14:65571923-65571945 AGGTTTACACAGAAGATAAAAGG + Intronic
1119982984 14:79103100-79103122 AGGTGTACAGAGAAGAACAGGGG - Intronic
1121302281 14:92881254-92881276 ATGTTTACACAGCAGACAAGTGG - Intergenic
1121439671 14:93940759-93940781 AGGATTTCACAGATGAATAGAGG - Intronic
1122452520 14:101821666-101821688 ATGTATACACAGTACAATACAGG - Intronic
1202845442 14_GL000009v2_random:168768-168790 TTGCTTATACAGAAGAATGGAGG - Intergenic
1202914841 14_GL000194v1_random:159034-159056 TTGCTTATACAGAAGAATGGAGG - Intergenic
1202875350 14_GL000225v1_random:202451-202473 TTGCTTATACAGAAGAATGGAGG + Intergenic
1202877828 14_KI270722v1_random:23675-23697 TTGCTTATACAGAAGAATGGAGG + Intergenic
1125005723 15:34814531-34814553 ATGTTGACACAGTTGAAAAGAGG + Intergenic
1125913481 15:43463129-43463151 ATGTTTTCAAACTAGAATAGTGG - Intronic
1127185444 15:56474949-56474971 AAATTTATATAGAAGAATAGAGG - Intergenic
1127922108 15:63502560-63502582 ATGTTTAAACTGAAGTCTAGGGG + Intergenic
1131948481 15:97653501-97653523 ATATTTTTACAGAATAATAGTGG + Intergenic
1132359931 15:101203634-101203656 ATTTTTACAGAGGAGAATCGTGG + Intronic
1133725346 16:8532294-8532316 AAGTTTACACAGAGGGCTAGAGG - Intergenic
1133886802 16:9836988-9837010 ATTTTTACACAAAAGCTTAGAGG + Intronic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1134675594 16:16087989-16088011 ATGTTTACACAGAATGTTAGTGG - Intronic
1137953007 16:52801465-52801487 CTGTTTACATAGATGAAAAGTGG - Intergenic
1139490972 16:67285854-67285876 ATGTTTAAGCTGAGGAATAGGGG + Intronic
1141966069 16:87444504-87444526 ATTTTTACACAGGAGAATCCTGG + Intronic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1146119948 17:30183847-30183869 ATCTTTGCACAGCAAAATAGTGG - Intronic
1146553529 17:33803196-33803218 ATGTTTTCACCTAACAATAGTGG - Intronic
1150534998 17:66028279-66028301 ATTTCTACACAGAAGAACAATGG - Intronic
1151335091 17:73435054-73435076 ATGTTTCCAAAGAAGAAAACTGG - Intronic
1152018728 17:77769285-77769307 GTGTCTTCACAGAAGAATGGTGG + Intergenic
1153504522 18:5782134-5782156 GTTTTTACACAGAAGGATGGAGG + Intergenic
1153596023 18:6725996-6726018 ATTTTTACACAGAACAATGGAGG - Intergenic
1154234498 18:12591418-12591440 ACTTTTACACTGAAGAAGAGGGG + Intronic
1155734964 18:29210403-29210425 ATTCTTACACAGAAAAATAAGGG - Intergenic
1155948573 18:31883658-31883680 ATGTTTTCAAAAAAGAAAAGAGG + Intronic
1159034768 18:63266225-63266247 ATGTAGACACAGAAGAGAAGAGG + Intronic
1159192715 18:65068735-65068757 ATGTTTACAGAGAAGAAAGTAGG - Intergenic
1159362927 18:67428639-67428661 ATGTTAATACAGAACAACAGTGG + Intergenic
1159550257 18:69887435-69887457 AAGTTTATACAGAAAAATACAGG - Intronic
1161776448 19:6265121-6265143 ATGTTTCCACAGAAAAAAACAGG + Intronic
1168391700 19:56013832-56013854 ATGGTTACAATGAAAAATAGTGG - Intronic
1168554926 19:57329969-57329991 ATGCATACACAGAAAAATAAAGG - Exonic
1202672850 1_KI270710v1_random:9268-9290 TTGCTTATACAGAAGAATGGAGG - Intergenic
925707424 2:6700060-6700082 AGGATTATACAGAAGAATATTGG + Intergenic
926026457 2:9549424-9549446 ATATATACACATAAGTATAGTGG + Intronic
927006404 2:18854052-18854074 AGGCTAACACAGAAGAATATGGG + Intergenic
927013850 2:18934991-18935013 ATGTTTACACACAACAATGGAGG - Intergenic
928090801 2:28373832-28373854 ATGTTTGCTCTGAAAAATAGGGG - Intergenic
928683218 2:33724278-33724300 ATGTTTACATTGAAAAATAAGGG - Intergenic
929095467 2:38259500-38259522 ATGGTGACACAGAAGGACAGGGG + Intergenic
930431566 2:51283327-51283349 AGGTTTACAAAAAACAATAGAGG + Intergenic
930601474 2:53448527-53448549 ATCTTTACTCAGAATAATGGGGG - Intergenic
931079680 2:58754639-58754661 ATGTACAAATAGAAGAATAGAGG - Intergenic
931704300 2:64934450-64934472 ATTTTTACACAGAAGAATCTAGG - Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
933520380 2:83364134-83364156 ATCTTTAAAGAAAAGAATAGTGG - Intergenic
935219482 2:101000485-101000507 CTGTTAACAAAGAAGAAGAGGGG - Intergenic
935446499 2:103162328-103162350 AAGTTTACATAAAAGAAAAGGGG - Intergenic
936513827 2:113169163-113169185 ATGTTGTCACAGAAGACAAGAGG - Intronic
937657789 2:124396556-124396578 TTGTTTACAAAGGAGAAAAGGGG - Intronic
937753926 2:125513376-125513398 AGGTTCAATCAGAAGAATAGAGG + Intergenic
938888191 2:135675459-135675481 ATGTTGGCACTGAAGTATAGGGG - Exonic
939836749 2:147138871-147138893 ATGTTTAAAAAGAAAAATAAAGG - Intergenic
939838508 2:147158059-147158081 ATGGTTGGACAGAAGAATAGAGG - Intergenic
940696090 2:156980833-156980855 ATTGTAACACAGAAAAATAGAGG - Intergenic
941600078 2:167531931-167531953 ATTTTTACAAAGAAGAATTTGGG + Intergenic
942371065 2:175285679-175285701 ATGTTTTCATAAAAGAAAAGTGG + Intergenic
943184206 2:184585634-184585656 ATATATACCCAGAAGAATATAGG - Intergenic
943523978 2:188993694-188993716 ATGTTTATATAAAAGAATAGAGG + Intronic
943746333 2:191466006-191466028 ATCTTTAAACAAAAGAATACGGG + Intergenic
945364885 2:208940283-208940305 ATGTTTACAAACAGAAATAGTGG + Intergenic
946988932 2:225305631-225305653 ATATTTGCACAGAGCAATAGTGG + Intergenic
947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG + Intergenic
947929644 2:233952948-233952970 TTGTTCAGACTGAAGAATAGGGG - Intronic
948374813 2:237514420-237514442 GTTTTTACACAGAAAAGTAGAGG + Intronic
1169564555 20:6839684-6839706 AGGTTTACAGAGAAGTAGAGTGG + Intergenic
1170203743 20:13774234-13774256 ATATTTAAACAGAATAATACAGG + Intronic
1170940737 20:20846011-20846033 ATGTTTCCACAAAAGAAAACCGG + Intergenic
1176634192 21:9173679-9173701 TTGCTTATACAGAAGAATGGAGG - Intergenic
1176639116 21:9281110-9281132 TTGCTTATACAGAAGAATGGAGG + Intergenic
1176980077 21:15371674-15371696 ATGTTAACACAAAAGATTACTGG - Intergenic
1177349324 21:19914236-19914258 ATGTTTCCAGAGGAGATTAGTGG - Intergenic
1177503233 21:21986331-21986353 GTGTTATCACAGAAGAGTAGAGG - Intergenic
1177538978 21:22466926-22466948 ATGTATACACAAAAGACTAAAGG + Intergenic
1177990679 21:28032064-28032086 ATGTTTTCACAAAAGAAAAATGG + Intergenic
1178149020 21:29772891-29772913 ACATTGACACAGAAGAATATAGG - Intronic
1180372422 22:12053953-12053975 TTGCTTATACAGAAGAATGGAGG + Intergenic
1180390044 22:12221699-12221721 TTGCTTATACAGAAGAATGGAGG - Intergenic
1180415892 22:12712770-12712792 TTGCTTATACAGAAGAATGGAGG + Intergenic
1180423162 22:12888617-12888639 TTGCTTATACAGAAGAATGGAGG + Intergenic
1182030831 22:27158010-27158032 ATCTATACACAGGAGAAGAGAGG + Intergenic
1182935535 22:34218443-34218465 ATTTTTACACAGAAAGGTAGAGG - Intergenic
949297696 3:2545471-2545493 ATATTTACACACAATAATAGTGG - Intronic
949698205 3:6723798-6723820 ATGTCTACAAAGAAAAATACTGG + Intergenic
952323579 3:32300367-32300389 ATTCTTACACAGAAAAGTAGGGG + Intronic
952440835 3:33326755-33326777 ATGTTTTCACAAAAGAATTGAGG + Intronic
955089577 3:55736168-55736190 ATCTTTACACAATAGAATGGTGG - Intronic
956147965 3:66211249-66211271 ATGGTAGCTCAGAAGAATAGAGG + Intronic
956354657 3:68377937-68377959 GTGGGTACACAGAAGAATTGAGG + Intronic
957684295 3:83481007-83481029 AGGTTTAAACAGAAGAATTTTGG - Intergenic
959629463 3:108491762-108491784 AGGTTTGCACAGAGGAATAGTGG - Intronic
959726681 3:109550998-109551020 ATGTTTACATAGAAAAAAAGAGG + Intergenic
960298739 3:115975750-115975772 TTATTTACACAGAAGATTATTGG - Intronic
963196128 3:142532267-142532289 ACGTTTACACATAAGAGAAGAGG - Intronic
965480608 3:169214390-169214412 ATGTTTACAAACAGGAATAATGG + Intronic
966221368 3:177554809-177554831 ATAATTTCACAGAAGAATGGGGG - Intergenic
966840847 3:184086065-184086087 ATGTTTACACAAAAGAGAAATGG + Intergenic
967123308 3:186402940-186402962 ATGTTCACTGAGAAGAATGGTGG + Intergenic
968197662 3:196722057-196722079 ATATTTACACAGAAAAAAACAGG - Intronic
1202747779 3_GL000221v1_random:123909-123931 TTGCTTATACAGAAGAATGGAGG - Intergenic
970841151 4:20470987-20471009 ATGTTTCTACAGAAGAAAAGGGG + Intronic
970883758 4:20962912-20962934 ATATTTTGACAGAAGAATATTGG + Intronic
971937776 4:33175138-33175160 ATGTTTACACAGATATATACAGG + Intergenic
973006044 4:45007998-45008020 TTGGTCACACAGAAGAATAATGG + Intergenic
974995608 4:69155781-69155803 ATGTTTACACACCAGCAGAGAGG - Intronic
976916393 4:90380599-90380621 AAATTTACAAAGAAGAATAAGGG - Intronic
977178348 4:93841584-93841606 ATACTTACAAAGAACAATAGGGG + Intergenic
977597898 4:98903765-98903787 ATGTTTACACAGAATGATTAAGG + Intronic
977688867 4:99880259-99880281 ATATTTACACTGAAGAAGGGAGG + Exonic
978463219 4:108980658-108980680 AAGTTAACACGGAAGAATTGTGG - Intronic
979917989 4:126462879-126462901 ATGTATACCCAGAAGAAAATTGG - Intergenic
980211262 4:129791290-129791312 ATCTTTGCCCAGAATAATAGAGG + Intergenic
981096709 4:140789299-140789321 ATGTTTCCAAAGAAAAATATAGG - Intergenic
981155441 4:141429376-141429398 ATGTTTCCACATAAGAATTCCGG + Intergenic
982334559 4:154219458-154219480 AAGTTAATACAGAAGAATAAAGG - Intergenic
982553738 4:156834841-156834863 ATGTTGAATCAAAAGAATAGTGG + Intronic
984143852 4:176036999-176037021 AAGTCTACACAGTAGACTAGTGG + Intergenic
984968327 4:185162716-185162738 ATGTTTACACAGAGAATTATAGG + Exonic
985148993 4:186927242-186927264 ATGTTTTAACAGAAGAATTTTGG - Intergenic
985472785 5:55943-55965 ATGTTTACATAGACGAATTTGGG + Intergenic
988031233 5:25765848-25765870 ATGTTTCCTTAGAAGAAAAGGGG + Intergenic
988161772 5:27526988-27527010 GTGTGTATACAGAAGAATAGTGG - Intergenic
989731793 5:44657522-44657544 ATGTTTACACACAACAACTGAGG + Intergenic
991442947 5:66670057-66670079 TTGTTTACACTGCAGAATTGGGG + Intronic
993519285 5:88880710-88880732 ATGTTTACAAAGAAGAAAAGAGG + Intronic
994585808 5:101708174-101708196 ATATTTTCACATAATAATAGTGG - Intergenic
996390364 5:122953611-122953633 ATGTTTCTACTGAAGAATGGAGG - Intronic
997051614 5:130387828-130387850 ATGTTTGCACAGAATAACATGGG + Intergenic
997402628 5:133613823-133613845 ATTTTTACTCAGAAGGATAAAGG + Intergenic
997634288 5:135393368-135393390 CTATTTACTCAGAAGAAAAGAGG + Intronic
998985129 5:147748546-147748568 AAGTTTGCACAGATGAATACTGG + Intronic
999091462 5:148940049-148940071 ATGGTTACACAGCAAATTAGAGG + Intronic
999099796 5:149014059-149014081 ATGTTTGCACAGTACATTAGGGG + Intronic
999900737 5:156084040-156084062 ATCTTTACAAAGAAAAATGGAGG - Intronic
1003164636 6:3665597-3665619 AAGTTTAAACAAAAGAAAAGAGG + Intergenic
1003215358 6:4104479-4104501 ATGATAACACAGAAGAACAAAGG + Intronic
1003355137 6:5361882-5361904 TTCTTTACACAGAAGAATGAGGG + Intronic
1003807668 6:9743962-9743984 AGATTTACACACAATAATAGTGG - Intronic
1005460772 6:26067654-26067676 GTTTTTACACAGAAAAACAGAGG + Intergenic
1005662867 6:28017797-28017819 ATGTTTAGAGATAAGAATAATGG - Intergenic
1006524900 6:34595953-34595975 ATGCAAACACAGAAGAATACAGG + Intronic
1010567980 6:77440971-77440993 ATCTTTACACATCAGAATTGTGG + Intergenic
1010981334 6:82373680-82373702 ATGTTTACAAAGGAGAATAATGG + Intergenic
1012020055 6:93906848-93906870 ATTTTTGGACAGCAGAATAGAGG + Intergenic
1012135168 6:95546564-95546586 ATGGTTAGACAAAAGGATAGTGG - Intergenic
1012660576 6:101885385-101885407 ATGGTTGTACAGAAAAATAGTGG + Intronic
1015015221 6:128404730-128404752 ATGATTTCACAGATGAAAAGAGG + Intronic
1017849031 6:158287126-158287148 ATGTTTACAGTGAAGAGGAGAGG + Intronic
1018130334 6:160724596-160724618 ATGTTTACACAGAAGAATAGTGG + Intronic
1018597215 6:165494318-165494340 GTATTTACCCAGAAGAAAAGAGG + Intronic
1020480393 7:8652949-8652971 TTGTTAACACAGAAAAATATAGG + Intronic
1020682587 7:11255471-11255493 ATGTTTACACAAAATAAAAACGG + Intergenic
1020706826 7:11554773-11554795 ATTTCTACACAGAAAAAAAGAGG - Intronic
1021402777 7:20228737-20228759 ATGTTCACACAGAAAAGCAGGGG + Intergenic
1021406088 7:20268677-20268699 ATATGTACACAGAAAAAGAGTGG - Intergenic
1021702107 7:23329628-23329650 TTGTTTTCACATAAGAGTAGTGG + Intronic
1022214824 7:28248548-28248570 ATGTCTACTCAGAGGATTAGTGG + Intergenic
1023574253 7:41608675-41608697 ATATATAGACAGAAGAACAGAGG - Intergenic
1024121823 7:46249854-46249876 ATGTTTGGACAGAAAAGTAGTGG + Intergenic
1028239200 7:88398852-88398874 CTGTTTTCCCAGAAGAATAAAGG - Intergenic
1030236663 7:107270725-107270747 ATGTTTAAACTGGAGAAAAGTGG + Intronic
1031631989 7:124054256-124054278 ATGTATAAACGGAAGAAAAGAGG + Intergenic
1032318272 7:130861179-130861201 GTGGGTACACAGAAGAATTGAGG + Intergenic
1032699192 7:134363908-134363930 AGGTTTCCACAGGAGAATGGAGG + Intergenic
1032817342 7:135490194-135490216 ATGTTTCAACAGAATGATAGTGG - Intronic
1033411551 7:141122773-141122795 AGATTTACAAAGAAGAAAAGTGG - Intronic
1033554490 7:142476931-142476953 TCGTTGCCACAGAAGAATAGCGG - Intergenic
1034875133 7:154718990-154719012 ATGTTCAGACACAAGAAGAGTGG - Intronic
1035915875 8:3621501-3621523 AAATTTACAGAGATGAATAGTGG + Intronic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1038923027 8:32106839-32106861 ATATTTACAGAGATGAATAAAGG - Intronic
1042287747 8:67132775-67132797 ATGTTTACAGAGGAGGATAATGG + Intronic
1042433972 8:68742441-68742463 CTGCTTACACAGATGAATACAGG - Intronic
1042463931 8:69104335-69104357 ATATTCAGACAGAAGAATAATGG - Intergenic
1045722323 8:105128027-105128049 ATGTATACATAGAACAAGAGTGG - Intronic
1045826761 8:106407126-106407148 ATGTTTCCACAAAAAAAGAGAGG - Intronic
1045844078 8:106613168-106613190 ATGTTCACACAGAGGGAAAGAGG + Intronic
1045910244 8:107399134-107399156 ATATTTGCACAGGAGAAGAGGGG + Intronic
1046084994 8:109421916-109421938 AAGTTTACACTGAAGAATACAGG + Intronic
1048605333 8:135962571-135962593 ATGTGTACACAGGAGAAAAAGGG + Intergenic
1048745215 8:137606930-137606952 ATGTTTAGACAAAAACATAGAGG + Intergenic
1049087188 8:140487966-140487988 ATGTTTCCAAGGAAGATTAGTGG + Intergenic
1050052215 9:1614988-1615010 TTTTTTACACAGAAGACTAAAGG - Intergenic
1050468365 9:5957756-5957778 ATGTTTTTACTGAAGAATACAGG - Intronic
1053371759 9:37567497-37567519 ATGTTTACTCATAGGAATTGAGG - Intronic
1053504968 9:38634649-38634671 ATATTTAGAAAGAAGAAAAGAGG - Intergenic
1057987211 9:99729598-99729620 ATCTCTACACAGAATAAGAGTGG - Intergenic
1058332257 9:103777593-103777615 ATTTGGACACAGAAGCATAGAGG - Intergenic
1058772160 9:108246122-108246144 CAGTTTACAAAGAAGAATATTGG + Intergenic
1059814545 9:117897540-117897562 ATATTTACACAGCAGAAAAGTGG - Intergenic
1061533462 9:131232683-131232705 AATTTTACACAGAAGCACAGAGG - Intronic
1203757031 Un_GL000218v1:141315-141337 TTGCTTATACAGAAGAATGGAGG - Intergenic
1203716414 Un_KI270742v1:153990-154012 TTGCTTATACAGAAGAATGGAGG - Intergenic
1203534800 Un_KI270743v1:24249-24271 TTGCTTATACAGAAGAATGGAGG + Intergenic
1203650642 Un_KI270751v1:117545-117567 TTGCTTATACAGAAGAATGGAGG - Intergenic
1185501582 X:600561-600583 ATGTTTATAGAGAAGATTACAGG + Intergenic
1186191519 X:7071546-7071568 GTTTTTACAGAGAAGAACAGAGG - Intronic
1186229297 X:7436299-7436321 ACGTTTACACAGAAAAATTTCGG + Intergenic
1187649765 X:21389767-21389789 AGGTTTACAAAAAAGAAAAGTGG - Intronic
1188489028 X:30716978-30717000 ATGTATAAACAGAACAATTGTGG + Intronic
1190332556 X:49244854-49244876 AGGTTGACAGAGAAGAAGAGGGG - Intronic
1190427768 X:50348745-50348767 ATGTTTACACAGCTGATGAGAGG + Intronic
1190627705 X:52352625-52352647 TTTTTTACACAGAAAAACAGAGG - Intergenic
1192219619 X:69188554-69188576 ATGGTTATACAGAAAAAAAGGGG - Intergenic
1193572677 X:83162592-83162614 ATTTTTACACAAAAGAAGATTGG - Intergenic
1194303331 X:92213531-92213553 ATGTATAAATATAAGAATAGAGG - Intronic
1194550026 X:95286001-95286023 ATGTTCACACAGAAGACTACTGG - Intergenic
1196185255 X:112738625-112738647 AAGTGTACACAGATGAATAGTGG - Intergenic
1197516945 X:127444095-127444117 ATGTTTACAAAATAGAAGAGTGG + Intergenic
1198193622 X:134337053-134337075 ATCATTACAGAGAAAAATAGTGG - Intergenic
1199492332 X:148414158-148414180 ATGCTTAAACAGAATAACAGAGG + Intergenic
1201170612 Y:11258939-11258961 TTGCTTATACAGAAGAATGGAGG - Intergenic
1201665489 Y:16448834-16448856 ATGTTGACAGAAAAGAAGAGAGG - Intergenic
1202200928 Y:22346801-22346823 ATGTGTACCCAGAGGCATAGGGG - Intronic