ID: 1018132644

View in Genome Browser
Species Human (GRCh38)
Location 6:160747413-160747435
Sequence ACCTCTGAGAAACTGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018132644_1018132650 9 Left 1018132644 6:160747413-160747435 CCCTGCTGCAGTTTCTCAGAGGT 0: 1
1: 0
2: 1
3: 18
4: 207
Right 1018132650 6:160747445-160747467 GCATTAGGAGTCTGAAGCCCTGG 0: 1
1: 0
2: 1
3: 13
4: 211
1018132644_1018132649 -6 Left 1018132644 6:160747413-160747435 CCCTGCTGCAGTTTCTCAGAGGT 0: 1
1: 0
2: 1
3: 18
4: 207
Right 1018132649 6:160747430-160747452 AGAGGTGCTAGGAGGGCATTAGG 0: 1
1: 0
2: 1
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018132644 Original CRISPR ACCTCTGAGAAACTGCAGCA GGG (reversed) Intronic
902200733 1:14831529-14831551 GCCGCTGAGAAACTGCTGAACGG - Intronic
902609193 1:17587416-17587438 ACCTCGGAGATCCTGCAGCCTGG + Intronic
903376903 1:22872248-22872270 ACATCTCAGAAGCAGCAGCAGGG + Intronic
903587331 1:24426193-24426215 TCCATTGAGAGACTGCAGCATGG + Intronic
905868116 1:41387363-41387385 TCCCCTGAGCACCTGCAGCAGGG + Intergenic
906304388 1:44707332-44707354 ACCTCTGAGCAACTCCAGGGAGG + Intronic
907109559 1:51914348-51914370 ACCTTTGAGAAACTGTTTCAGGG - Exonic
907553315 1:55323248-55323270 ATCTCTAAGAAACTGAAGTATGG + Intergenic
913016073 1:114736571-114736593 TCCTCTGAGACCCTGCATCATGG + Intronic
914937071 1:151991008-151991030 TCCTCTTTGAAACTGCAGCCGGG - Intronic
920049099 1:203152531-203152553 ACCTGTGAGTAGCTGCTGCAGGG - Intronic
920733228 1:208508288-208508310 ACTTCTGAGAAAATGCAGACGGG + Intergenic
922753350 1:228081479-228081501 ACCTCTGTGAAGCTGTGGCAGGG - Intergenic
923109665 1:230880483-230880505 ACCCCTGAGCAGCTGCTGCAAGG + Intergenic
923142705 1:231174619-231174641 ACATCTGAGAAAATGCAGAGTGG - Intronic
923679793 1:236110348-236110370 ACTGCTGATGAACTGCAGCATGG - Intergenic
924037856 1:239954559-239954581 ACCTAAGAGAAACTGAGGCATGG + Intergenic
924909780 1:248497816-248497838 ACCTCTCATAAACTGCTGAAGGG - Intergenic
924914322 1:248550244-248550266 ACCTCTCATAAACTGCTGAAGGG + Intergenic
1063274199 10:4546626-4546648 ACTTCTGAGAAACTGCGGAATGG + Intergenic
1063437425 10:6045753-6045775 TCTTCTGAGAAACTGGAGCGAGG + Intronic
1066107031 10:32165301-32165323 ACCACTGCTAAACTGCAGCCTGG - Intergenic
1067365781 10:45627336-45627358 AACTCTGAGAAACAGCAGTAAGG - Intronic
1067374134 10:45711719-45711741 ACCCCTGAGAAACAGCATGATGG - Intergenic
1067379552 10:45760543-45760565 ACCCCTGAGAAACAGCATGATGG + Intronic
1067881966 10:50053473-50053495 ACCCCTGAGAAACAGCATGATGG - Intergenic
1067887251 10:50101200-50101222 ACCCCTGAGAAACAGCATGATGG + Intronic
1069103259 10:64350875-64350897 AGTGCTGAGAAACAGCAGCAGGG + Intergenic
1070498858 10:77051525-77051547 CACTCTGAGAAACTGCAGAGGGG - Intronic
1071062804 10:81592827-81592849 ACCTCTGGGATACAGCAACAGGG + Intergenic
1071363951 10:84879603-84879625 GCCTCTGAGAAACTGCTCCTGGG + Intergenic
1071411205 10:85398541-85398563 ACCCCTGGAAAACTGCAGAAAGG - Intergenic
1071919151 10:90329740-90329762 ACCTCTGAGATGGAGCAGCATGG + Intergenic
1073212980 10:101819389-101819411 AGCTCTGAGAACATACAGCAAGG - Intergenic
1073261318 10:102192663-102192685 ACCCCTAAGCAGCTGCAGCATGG + Intergenic
1075011344 10:118872893-118872915 ACCTGTGAGAAAGTGAAGCTTGG + Intergenic
1075747329 10:124736836-124736858 CCCTCCTAGAAGCTGCAGCATGG + Intronic
1077472967 11:2772895-2772917 AGCTCTGTGAAGCTGAAGCATGG - Intronic
1078465936 11:11550318-11550340 ACCTCTCAGAAAATGATGCAAGG + Intronic
1079555681 11:21756094-21756116 AGATCTGATAAACTTCAGCAAGG - Intergenic
1080040663 11:27756414-27756436 AAATCTCAGAACCTGCAGCATGG + Intergenic
1080279482 11:30540041-30540063 ACCTCTGAGAAAGCTGAGCATGG + Intronic
1081619119 11:44608480-44608502 ACTTCTGTGAAAATGCAGAATGG + Intronic
1082089752 11:48079671-48079693 ACCCTTGAGAAGCTGCAGCTGGG - Intronic
1083056639 11:59827670-59827692 ACCACTGAAACACTCCAGCATGG + Intergenic
1083255889 11:61495251-61495273 CCCTGTGACAATCTGCAGCATGG - Intergenic
1084897903 11:72288525-72288547 AGCTCTGAGACAATGCAGCAAGG - Intergenic
1085087931 11:73684609-73684631 ACCTCGGAGATACTGCAGTCTGG - Intronic
1086061832 11:82707962-82707984 ACTCCTGAGAAACTCGAGCACGG + Intergenic
1088635835 11:111819731-111819753 CTCTGTGAGCAACTGCAGCAAGG + Intronic
1088685324 11:112280180-112280202 ATCTCTGAGAACCTGCAGGAAGG - Intergenic
1090465116 11:126926479-126926501 GGCTCTGAGAGACTGCAGGAAGG + Intronic
1090486768 11:127119602-127119624 AACTCTGAGAATCTGGAGGAAGG + Intergenic
1092976425 12:13749498-13749520 TCCTCTCAGCAACTGCAGTAGGG - Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1095078851 12:37971305-37971327 CTCTCTGAGAAACTGCTTCATGG + Intergenic
1096792681 12:54054752-54054774 AGCTCTGAGAAACAGGAGGAGGG - Intronic
1097451722 12:59744760-59744782 ACCTCCTAGACACTGCTGCAGGG + Intronic
1097880180 12:64679769-64679791 TCCTCTGAGAAACTGCTGGAGGG + Intronic
1098401442 12:70080863-70080885 GCCATTGAGAAACAGCAGCAGGG + Intergenic
1098562945 12:71898556-71898578 ACAAATGAGAAACTGAAGCATGG + Intronic
1099634843 12:85200528-85200550 ACCTCTTATAAACTGTAACAAGG - Intronic
1100779564 12:98009437-98009459 ACCTATGAGGGGCTGCAGCATGG + Intergenic
1101404151 12:104413232-104413254 ACATCTGAGAAACTGAAGTTCGG - Intergenic
1102339076 12:112108000-112108022 ACCACAGAGAAGCTGCAGAAAGG + Intronic
1103480960 12:121249428-121249450 CCCTTTGAGAAACTGCAGTGAGG - Intronic
1104094124 12:125540951-125540973 ACATCTGAGAAACAGCAACAAGG - Intronic
1104221773 12:126791483-126791505 ACTCCTGAGCAACTGCAGAAAGG - Intergenic
1104487104 12:129161155-129161177 ACATCTGAGGAACAGCAGGAAGG + Intronic
1106477461 13:30110777-30110799 TCCTCTGAGACAAAGCAGCAAGG - Intergenic
1107001710 13:35553917-35553939 ACCTCTGAGAAACTGGTGTTTGG + Intronic
1107884562 13:44864561-44864583 ACTTCTGAGAAACTCCTTCAAGG + Intergenic
1110776821 13:79417380-79417402 ACCTTTGGGAAACATCAGCATGG - Intergenic
1111120814 13:83846710-83846732 ACTTCTGAGGAACAGCAGGAAGG + Intergenic
1111405021 13:87793006-87793028 ACCTGTAAGAATGTGCAGCAGGG + Intergenic
1113815623 13:113168522-113168544 ACATGTGAGGAACAGCAGCAGGG - Intronic
1115504547 14:34080682-34080704 AGCTCTCAGAAGCTGCACCAGGG - Intronic
1116576319 14:46580762-46580784 ACTTCTAAGAAACCACAGCAGGG - Intergenic
1116938888 14:50770710-50770732 ACATCTGAGTCACTCCAGCAAGG + Intronic
1119016342 14:71059879-71059901 ACATCTAAGAAACTGCAAGAAGG - Intronic
1119773984 14:77237303-77237325 ATCTCCGAGAGACTGCAGAAGGG - Intronic
1120032268 14:79655638-79655660 ACTATTGAGAAACTGCACCAGGG - Intronic
1120905092 14:89613280-89613302 ACCTGTTAGCAACTTCAGCAAGG + Intronic
1121382262 14:93483011-93483033 GCCTTTGTGAAACTGCAGAAAGG - Intronic
1122289301 14:100671310-100671332 ACCTCTGAAACATTGAAGCACGG + Intergenic
1122375825 14:101256449-101256471 GCCCCTGAGAAACTCAAGCACGG - Intergenic
1122830698 14:104394208-104394230 ACCTCTGAGACACAGAGGCATGG - Intergenic
1124631983 15:31343247-31343269 TCCTGGGAGAAACAGCAGCAAGG + Intronic
1124988325 15:34645254-34645276 AGCTCTGGGATACTGGAGCAGGG + Intergenic
1125430630 15:39589771-39589793 AGCTCTGTGTAACAGCAGCATGG + Intronic
1126336156 15:47588285-47588307 ACTTCAGTGAAACTCCAGCAAGG + Intronic
1126910368 15:53411074-53411096 TTCTCTGAGCAGCTGCAGCATGG + Intergenic
1127082763 15:55396848-55396870 ACCTCTGAGAAACAGCAAGGAGG + Intronic
1129744107 15:78006466-78006488 ACATCTGAGAAACTGGGACAGGG + Intronic
1129788454 15:78324346-78324368 AGCACTGAGATACAGCAGCAGGG + Intergenic
1130018108 15:80202744-80202766 CCCTGTGAGGACCTGCAGCAGGG - Intergenic
1131979000 15:97977542-97977564 ACATCTGAGAAACTGCACTGAGG + Intergenic
1134097022 16:11424734-11424756 ACTTCTGAGAAGCTCGAGCAGGG + Intronic
1138038770 16:53637796-53637818 AATACTGAGAAAATGCAGCAAGG - Exonic
1138569396 16:57859515-57859537 AGCTCTCAGAAACTCCAGCAGGG + Intronic
1138828041 16:60344648-60344670 GCCTCTGACCAACTGCAGAATGG - Intergenic
1140030462 16:71333812-71333834 ACCTCTGAGAAATTGAATAAGGG + Intergenic
1141367851 16:83460515-83460537 ACGTCTGATGAACTGCAGCAAGG + Intronic
1151769933 17:76153950-76153972 TCCACTGAAAACCTGCAGCAGGG + Intronic
1152090555 17:78244436-78244458 AGCTATGAGAAACCACAGCATGG - Intergenic
1152666175 17:81570893-81570915 ACTTCTGAAAAACTGCACTAAGG + Intronic
1153020999 18:629073-629095 ACCTTTCAGAAACTGAAGCTAGG + Intronic
1156385818 18:36604056-36604078 ACCTCTGAGGAAGAGCACCAAGG - Intronic
1158070348 18:53462813-53462835 GCCTCTGGGAAATTCCAGCAAGG + Intronic
1158879413 18:61762450-61762472 AGCACTGGGAAAGTGCAGCAAGG + Intergenic
1159865451 18:73699045-73699067 TCCTCTGAAAAATTCCAGCAAGG - Intergenic
1160065947 18:75574469-75574491 ACCACTGAGAAACTCTAGCAGGG + Intergenic
1160462382 18:79048787-79048809 GGCTCTGAGGAAATGCAGCAAGG - Intergenic
1161217116 19:3100087-3100109 TGCTCTGAGAAACTGCTCCATGG + Intronic
1163440286 19:17319288-17319310 ACCTCTGTGATGCTGCTGCAGGG + Intronic
1164679903 19:30127162-30127184 CCTTCTGAGAACCTGCAGCAGGG - Intergenic
1165991315 19:39816276-39816298 CCCTCTGAGAACCTGGAGCCTGG + Intergenic
926103567 2:10136472-10136494 ACCTCTGATAAAGGGCAACAGGG - Intergenic
926308755 2:11659390-11659412 ACTGCAGAGAACCTGCAGCAAGG - Intronic
926847601 2:17159564-17159586 ACATCTGAGAGACTGCTGCCTGG - Intergenic
927241672 2:20924942-20924964 ACCTCTGGGTCAATGCAGCAGGG - Intergenic
929199508 2:39220262-39220284 AGATCTGAGAGTCTGCAGCAAGG - Intronic
930868911 2:56150230-56150252 AACTCTGAGGAACTGCATGAAGG - Intergenic
931061327 2:58532773-58532795 ACCTGTGACAAACTGCCTCAGGG - Intergenic
931788104 2:65639663-65639685 CCTGCTGAGGAACTGCAGCAGGG + Intergenic
932598129 2:73106906-73106928 ACCTCCGAGAAGCTGCAGGGTGG - Intronic
933934295 2:87188537-87188559 ACCTCTGGGAAACTCAAGCTGGG - Intergenic
934936794 2:98471549-98471571 GCCTGTGAGAAGCAGCAGCATGG - Intronic
936358847 2:111777358-111777380 ACCTCTGGGAAACTCGAGCTGGG + Intronic
936438843 2:112532648-112532670 ACCCCTGAGTAACGGCATCATGG - Exonic
937150844 2:119684630-119684652 GCCTCTGAGCAATTACAGCAAGG + Intronic
937465778 2:122131823-122131845 AGCCCTGAGAAGCTGCAGCTTGG - Intergenic
938408283 2:131044744-131044766 AACTCTGCGAAACTGTATCATGG - Intronic
939901728 2:147858737-147858759 ACAGCTGAGAAACTGCAAAAGGG - Intronic
941112050 2:161426812-161426834 ACATCTGTCAAACTGCAGAAAGG - Intronic
942882748 2:180882879-180882901 AGCCCTGAGAAACTGCAGCTTGG + Intergenic
943187921 2:184637923-184637945 ACCCCTGGGAAACTGGAGAATGG + Intronic
947529908 2:230902294-230902316 AGCTTGGAGAAACAGCAGCAGGG - Intergenic
947782868 2:232785366-232785388 AGCTTTGAGAGACTGCAGCATGG - Intronic
947976273 2:234368916-234368938 ACCTCTGAGTCACTGCATGAAGG + Intergenic
1169591638 20:7149261-7149283 ACCCCTTAAAAACTGTAGCAAGG + Intergenic
1170769550 20:19320001-19320023 ACTTCTCAGCAGCTGCAGCATGG + Intronic
1173228405 20:41175475-41175497 ACCAGTTAGAAGCTGCAGCAAGG - Exonic
1175011782 20:55745026-55745048 ACAGCTGAGAAACCCCAGCACGG + Intergenic
1175835951 20:61994590-61994612 ACCTCTGAGAAATGGCTGCCTGG - Intronic
1176719952 21:10384740-10384762 ACCCATGAGAAGCTCCAGCATGG + Intergenic
1180301172 22:11037649-11037671 ACCCATGAGAAGCTCCAGCATGG + Intergenic
1181787044 22:25234918-25234940 AGCTCTGAGAAACTCCACAAAGG + Intergenic
1181819050 22:25461529-25461551 AGCTCTGAGAAACTCCACAAAGG + Intergenic
1182835947 22:33341430-33341452 ATCTATGAGAGTCTGCAGCAGGG + Intronic
1185369830 22:50455900-50455922 ACCCCCGAGAGAATGCAGCAGGG + Intronic
951930737 3:27964298-27964320 ACCTCTCAGAAACTGGAATATGG - Intergenic
954334397 3:49907884-49907906 AACTCTCAGAAACTGCATGAGGG + Intronic
954869131 3:53753885-53753907 AATTCTGAGAAACAGAAGCAGGG + Intronic
955905693 3:63805463-63805485 GCCTCTGTGAAACTGCAGTATGG - Intergenic
957414092 3:79878391-79878413 CCCTCCCAGACACTGCAGCAGGG - Intergenic
959109498 3:102105194-102105216 AGCTCACAGAAACTGGAGCAGGG - Intronic
961507046 3:127376965-127376987 CCCTCTGAGAAATTGTAACAGGG + Intergenic
962027310 3:131561675-131561697 ACCTCTGTGTCACTGCAGGAGGG + Intronic
962680884 3:137799191-137799213 ACTTCTGAGAAACTGAATTAAGG + Intergenic
962851664 3:139312810-139312832 ACCTTAGGGAAACTGCAGAATGG + Intronic
962905425 3:139797211-139797233 ACTTATGAAAAACTGCAGCTTGG + Intergenic
969185405 4:5470679-5470701 ACTGCTGAGAAACTGCAGCAAGG - Intronic
969321935 4:6417677-6417699 ACCTCTGACTCACTGCTGCAAGG - Intronic
970933493 4:21540782-21540804 ACCTCTGAACACCTACAGCAGGG - Intronic
975138344 4:70896092-70896114 CTCTCTGGGAAACTTCAGCAAGG + Intergenic
975170593 4:71227878-71227900 ACCTCTGAGAAAATGTTGGAAGG + Intronic
978364809 4:107970203-107970225 AGGTCTGAGGAACAGCAGCAGGG + Intergenic
985088041 4:186334380-186334402 ACCTTTGTGAAACTGCACCAAGG - Intergenic
990739382 5:58896652-58896674 ACCACTGAGACACTGAAGTAAGG + Intergenic
991012870 5:61901943-61901965 ACAGCTGAGAAACTGAGGCATGG + Intergenic
994110263 5:95995072-95995094 ACATCTGAGAAGCTGCTCCAAGG - Intergenic
996490067 5:124084238-124084260 ACCTCTGTGAGACTGCAGACTGG - Intergenic
996590906 5:125146984-125147006 ACCTCTGAGAAGCTCCACCTGGG + Intergenic
997823590 5:137087183-137087205 CCATCTGATGAACTGCAGCAGGG + Intronic
998165294 5:139839196-139839218 AGCCCTGAGAACCTGCAGCATGG - Intronic
998242335 5:140458607-140458629 ACTTCTGAAAATCTGCAGGATGG + Exonic
998418085 5:141959824-141959846 AGCTCTGAGACACTGCACAAGGG + Intronic
998481094 5:142463566-142463588 ACCAATGAGAAACAGGAGCAGGG - Intergenic
998761136 5:145433588-145433610 ACCTCTGAGGGACTGAGGCAAGG - Intergenic
998927393 5:147141810-147141832 ACCTCCAGCAAACTGCAGCAAGG - Intergenic
999156157 5:149458896-149458918 AGCTCTGAGAAACAGCCACATGG - Intergenic
1000087403 5:157900074-157900096 ACCTGGGAGAAACTCCAGCCTGG - Intergenic
1000625474 5:163533428-163533450 ACCTTTGAGTAACTGAACCACGG + Intergenic
1001313727 5:170628614-170628636 ACCTGTCATAAACCGCAGCATGG + Intronic
1003383798 6:5649082-5649104 CCCTCTAACAAATTGCAGCATGG - Intronic
1004311985 6:14553964-14553986 GCTTCTGAGCTACTGCAGCAGGG + Intergenic
1006175558 6:32119334-32119356 ACCTCTGAGGAGCAGTAGCAGGG - Intronic
1006728755 6:36219225-36219247 ATCTCAGAGAAACCACAGCAGGG - Intronic
1007287263 6:40756493-40756515 ACCTCTGAGTAAGGGCAGAAGGG + Intergenic
1012965886 6:105672386-105672408 ACCTCTGGGATACTGCAAAAGGG + Intergenic
1013479857 6:110544156-110544178 CCCTGGGAGAGACTGCAGCAGGG - Intergenic
1013678744 6:112498454-112498476 ACCTCTGAAAATTTGCACCAAGG - Intergenic
1018132644 6:160747413-160747435 ACCTCTGAGAAACTGCAGCAGGG - Intronic
1019326734 7:442132-442154 CCTGCTGAGAAACGGCAGCAGGG + Intergenic
1019675186 7:2307320-2307342 TCCTCTGAGAAACTGGAGCGCGG - Intronic
1021202476 7:17741837-17741859 ACTTCTGTGCACCTGCAGCAAGG + Intergenic
1028405476 7:90469377-90469399 ACATCAGAGAAAAGGCAGCATGG + Intronic
1031078971 7:117240178-117240200 ACCTCTGGGAAAGTGCGCCAGGG + Intergenic
1035739009 8:1912124-1912146 ACCAGTGAGCAGCTGCAGCAGGG + Intronic
1035877630 8:3208722-3208744 CCATCTAATAAACTGCAGCATGG + Intronic
1035954563 8:4061980-4062002 ACCTCTCAGACAGGGCAGCAGGG - Intronic
1037281326 8:17246245-17246267 TTCTCTGGGAAACTGCAGTACGG - Intronic
1037943601 8:22973058-22973080 ACTTCTGAGAACAGGCAGCAAGG - Intronic
1041235783 8:55801048-55801070 GCATCTGAGAAACTGAAACAAGG - Intronic
1041271551 8:56113894-56113916 AGCTCTGAGGGACTGCTGCAGGG + Exonic
1041542806 8:59005989-59006011 ACATCTGGGAAACTGAGGCATGG - Intronic
1049143750 8:140981889-140981911 AGCTCTGAGAACCTGGAGGAAGG - Intronic
1050158307 9:2691262-2691284 ACCTCTAATCAACGGCAGCAAGG + Intergenic
1050375762 9:4971152-4971174 ACGTTTGAGACACAGCAGCACGG - Intergenic
1052322122 9:27179319-27179341 AACAATGAGAAACTTCAGCAGGG - Intronic
1052679711 9:31673687-31673709 AACTTTGAGAAACTGGACCAAGG - Intergenic
1056931657 9:90883047-90883069 AGCTCTGAGTAGCTGCAGCTTGG + Intronic
1057576610 9:96247437-96247459 ACCTCTGAGGAGCTGCTGCAGGG - Intronic
1057969148 9:99536698-99536720 TCCTCTAAGAAACTGAAACATGG + Intergenic
1058131503 9:101259129-101259151 ACCACTGAGACACTGGAGGAAGG + Intronic
1059995723 9:119906884-119906906 ACCTCTGAGAAGATACAGAAAGG + Intergenic
1060052352 9:120386380-120386402 ACCTGAGAGAAACAGCTGCAGGG - Intergenic
1186234675 X:7494773-7494795 ACCTTTCAGAAACTGTTGCATGG + Intergenic
1186316268 X:8373854-8373876 AACTCTTAGAAAGTACAGCATGG + Intergenic
1191732073 X:64347428-64347450 GCTTCTGAGAAACTGAAGGATGG + Intronic
1195016453 X:100786365-100786387 CCCTCTTAGAAACTCCAGCAGGG + Intergenic
1196986861 X:121282788-121282810 AACCCTGAGAAACTACAGCTTGG - Intergenic
1198795223 X:140387391-140387413 GCCTCTGAGAAACAGCGACAGGG - Intergenic
1202269094 Y:23053331-23053353 ACCCCTGAAGAACTACAGCAAGG - Intergenic
1202422086 Y:24687071-24687093 ACCCCTGAAGAACTACAGCAAGG - Intergenic
1202448700 Y:24983007-24983029 ACCCCTGAAGAACTACAGCAAGG + Intergenic