ID: 1018134661

View in Genome Browser
Species Human (GRCh38)
Location 6:160767526-160767548
Sequence CCGGGCGCCCTCGCCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018134661_1018134670 12 Left 1018134661 6:160767526-160767548 CCCAGGGAGGCGAGGGCGCCCGG No data
Right 1018134670 6:160767561-160767583 TCTGCCGCCCCCTGCCGGCTTGG No data
1018134661_1018134669 7 Left 1018134661 6:160767526-160767548 CCCAGGGAGGCGAGGGCGCCCGG No data
Right 1018134669 6:160767556-160767578 TGGGGTCTGCCGCCCCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018134661 Original CRISPR CCGGGCGCCCTCGCCTCCCT GGG (reversed) Intergenic
No off target data available for this crispr